Mutagenetix > Incidental Mutation

Incidental Mutation 'R4208:Steap4'

319017

Institutional Source

Beutler Lab

Gene Symbol

Steap4

Ensembl Gene

ENSMUSG00000012428

Gene Name

STEAP family member 4

Synonyms

Tiarp, Tnfaip9

MMRRC Submission

041037-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R4208 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7960457-7982213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7980404 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 420 (Y420C)

Ref Sequence

ENSEMBL: ENSMUSP00000111081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115421]

AlphaFold

Q923B6

Predicted Effect

probably damaging
Transcript: ENSMUST00000115421
AA Change: Y420C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: Y420C

Domain	Start	End	E-Value	Type
Pfam:F420_oxidored	21	107	2.3e-16	PFAM
transmembrane domain	203	225	N/A	INTRINSIC
Pfam:Ferric_reduct	247	395	2.6e-14	PFAM
transmembrane domain	416	438	N/A	INTRINSIC

Meta Mutation Damage Score

0.2041

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.1%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,931,647	D527V	probably damaging	Het
A1cf	T	C	19: 31,932,660	L284P	probably benign	Het
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Abcc6	A	C	7: 45,986,563	L1020R	probably damaging	Het
Ace2	A	G	X: 164,169,585	I110V	probably benign	Het
Adamts12	A	G	15: 11,071,754	H128R	probably benign	Het
Apol9a	G	C	15: 77,404,396	T257S	probably benign	Het
B4galnt3	A	G	6: 120,215,102	S557P	probably damaging	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Casp12	T	C	9: 5,346,629	L52P	probably damaging	Het
Cep126	C	T	9: 8,100,821	E571K	probably damaging	Het
Cfhr1	A	G	1: 139,547,878		probably benign	Het
Cmah	A	G	13: 24,417,427		probably null	Het
Col10a1	C	T	10: 34,395,543	P504S	probably damaging	Het
Ctnna3	T	A	10: 64,959,778	D758E	probably benign	Het
Cyp2c65	T	C	19: 39,090,655	S393P	probably damaging	Het
Dclk2	A	G	3: 86,830,822		probably null	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
F13b	G	T	1: 139,516,341	W471L	probably damaging	Het
Fam181a	A	G	12: 103,315,914	D26G	probably damaging	Het
Gabpb2	A	G	3: 95,203,934		probably benign	Het
Gm7293	A	G	9: 51,623,579		noncoding transcript	Het
H3f3a	C	T	1: 180,803,138	R117H	probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kif3b	G	A	2: 153,323,557	R628Q	probably damaging	Het
Lars	T	C	18: 42,229,703	E557G	probably benign	Het
Ldlrad3	C	T	2: 101,953,162	D240N	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Lsr	A	G	7: 30,973,094	I27T	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Met	T	C	6: 17,548,729	V924A	possibly damaging	Het
Mpp3	T	C	11: 102,000,600	T571A	probably benign	Het
Olfr1231	A	T	2: 89,302,926	I222N	probably damaging	Het
Olfr665	A	G	7: 104,881,603	T299A	probably damaging	Het
Padi1	C	A	4: 140,817,227	V552L	possibly damaging	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
RP24-126A19.1	C	A	5: 146,895,796	R123L	noncoding transcript	Het
Scn10a	T	A	9: 119,616,776	E1438V	probably damaging	Het
Sfmbt2	T	A	2: 10,542,982	D458E	probably damaging	Het
Slitrk3	T	A	3: 73,051,157	Y94F	possibly damaging	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Trbv23	A	T	6: 41,216,088	I6F	probably benign	Het
Vmn1r87	A	G	7: 13,132,258	V34A	probably benign	Het
Zc3h7a	C	T	16: 11,164,644	E6K	possibly damaging	Het
Zfp606	G	A	7: 12,494,175	C683Y	probably damaging	Het

Other mutations in Steap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Steap4	APN	5	7976979	missense	probably damaging	1.00
IGL00827:Steap4	APN	5	7976712	missense	probably damaging	1.00
IGL01481:Steap4	APN	5	7976858	missense	probably damaging	0.98
IGL02378:Steap4	APN	5	7976741	missense	probably benign	0.00
IGL03058:Steap4	APN	5	7975664	missense	probably benign	0.00
PIT4362001:Steap4	UTSW	5	7980337	missense	probably benign	0.03
R0329:Steap4	UTSW	5	7975829	missense	possibly damaging	0.92
R0546:Steap4	UTSW	5	7975870	missense	probably damaging	0.99
R0637:Steap4	UTSW	5	7978398	splice site	probably benign
R0638:Steap4	UTSW	5	7977030	splice site	probably benign
R0651:Steap4	UTSW	5	7980348	nonsense	probably null
R0881:Steap4	UTSW	5	7980388	missense	probably benign
R1167:Steap4	UTSW	5	7976520	missense	probably benign	0.34
R1543:Steap4	UTSW	5	7975902	splice site	probably benign
R1889:Steap4	UTSW	5	7975892	missense	probably damaging	1.00
R3803:Steap4	UTSW	5	7976979	missense	probably damaging	1.00
R3811:Steap4	UTSW	5	7977017	missense	probably benign	0.18
R3885:Steap4	UTSW	5	7980494	missense	probably damaging	1.00
R3887:Steap4	UTSW	5	7980494	missense	probably damaging	1.00
R4051:Steap4	UTSW	5	7980404	missense	probably damaging	1.00
R5016:Steap4	UTSW	5	7976699	nonsense	probably null
R5302:Steap4	UTSW	5	7975547	nonsense	probably null
R5951:Steap4	UTSW	5	7975769	missense	probably benign	0.00
R6136:Steap4	UTSW	5	7978562	missense	probably damaging	0.99
R6527:Steap4	UTSW	5	7978502	missense	probably damaging	0.99
R6631:Steap4	UTSW	5	7976995	nonsense	probably null
R6964:Steap4	UTSW	5	7975568	missense	probably damaging	1.00
R7055:Steap4	UTSW	5	7976858	missense	probably damaging	1.00
R7408:Steap4	UTSW	5	7978453	missense	probably benign	0.07
R7692:Steap4	UTSW	5	7976976	missense	probably benign	0.32
R8205:Steap4	UTSW	5	7976795	missense	possibly damaging	0.65
R8861:Steap4	UTSW	5	7975672	missense	probably benign	0.00
R9287:Steap4	UTSW	5	7976683	missense	probably benign	0.05
R9423:Steap4	UTSW	5	7976720	missense	probably damaging	0.99
R9504:Steap4	UTSW	5	7980538	missense	probably benign	0.00
R9531:Steap4	UTSW	5	7978424	missense	probably benign	0.20
R9566:Steap4	UTSW	5	7975646	missense	possibly damaging	0.51

Predicted Primers

PCR Primer
(F):5'- TACGTTTCATTGGCATGCAG -3'
(R):5'- GCCATGACAAGAGAAAATGCTTTC -3'

Sequencing Primer
(F):5'- TCATTGGCATGCAGTATTTCAC -3'
(R):5'- TACTGCAATAGTACACAAATCCTGG -3'

Posted On

2015-06-10