Incidental Mutation 'R6581:Vmn1r158'
ID523435
Institutional Source Beutler Lab
Gene Symbol Vmn1r158
Ensembl Gene ENSMUSG00000094700
Gene Namevomeronasal 1 receptor 158
SynonymsGm16455
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R6581 (G1)
Quality Score125.008
Status Not validated
Chromosome7
Chromosomal Location22789859-22790782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22790040 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 248 (T248I)
Ref Sequence ENSEMBL: ENSMUSP00000133990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174643]
Predicted Effect possibly damaging
Transcript: ENSMUST00000174643
AA Change: T248I

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133990
Gene: ENSMUSG00000094700
AA Change: T248I

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 2.9e-15 PFAM
Pfam:7tm_1 39 290 5.5e-9 PFAM
Pfam:V1R 41 298 3.2e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,380,842 V51M probably damaging Het
Armc4 C T 18: 7,129,560 V873I possibly damaging Het
Cdh17 A T 4: 11,799,615 I471F probably damaging Het
Dnajb7 T A 15: 81,408,025 E37V probably damaging Het
Dpy19l1 T A 9: 24,447,864 I337F possibly damaging Het
Etv5 C T 16: 22,439,699 probably benign Het
Gbp2b T A 3: 142,608,238 Y426* probably null Het
Gm21103 A T 14: 6,303,815 N78K probably damaging Het
Helz2 A G 2: 181,229,379 V2755A probably damaging Het
Itga9 A T 9: 118,658,564 E238D probably benign Het
Itgb8 A T 12: 119,163,215 C736S probably benign Het
Luzp1 A G 4: 136,540,631 E55G probably damaging Het
Mkl1 A G 15: 81,016,373 L589P probably damaging Het
Ms4a4d G A 19: 11,554,840 V117M probably damaging Het
Olfr411 A G 11: 74,347,206 F126S probably damaging Het
Olfr453 T C 6: 42,744,079 L14P probably damaging Het
Olfr69 T C 7: 103,768,221 I59V probably benign Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Slc12a5 T C 2: 164,987,115 F525S probably damaging Het
Smyd5 G A 6: 85,432,023 D7N probably damaging Het
Spata18 G T 5: 73,669,516 R152L probably benign Het
Thbd A G 2: 148,406,272 S559P probably benign Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Tnpo2 C A 8: 85,055,404 P874Q probably damaging Het
Uchl4 A T 9: 64,235,793 E185D possibly damaging Het
Vmn1r5 T C 6: 56,985,381 F14L probably benign Het
Yaf2 T C 15: 93,286,414 T101A probably benign Het
Other mutations in Vmn1r158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vmn1r158 APN 7 22790779 missense probably benign 0.01
R1173:Vmn1r158 UTSW 7 22790445 missense probably benign 0.19
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1725:Vmn1r158 UTSW 7 22790647 missense probably benign 0.08
R1777:Vmn1r158 UTSW 7 22790430 missense probably damaging 1.00
R1813:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R1896:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R2077:Vmn1r158 UTSW 7 22790390 missense probably benign 0.03
R3749:Vmn1r158 UTSW 7 22790214 missense probably damaging 1.00
R4872:Vmn1r158 UTSW 7 22790754 missense possibly damaging 0.94
R5238:Vmn1r158 UTSW 7 22790374 missense probably benign
R6500:Vmn1r158 UTSW 7 22790653 missense possibly damaging 0.89
R6511:Vmn1r158 UTSW 7 22790691 missense probably benign 0.00
R6751:Vmn1r158 UTSW 7 22789881 missense probably damaging 0.96
R7168:Vmn1r158 UTSW 7 22790676 missense possibly damaging 0.82
R7337:Vmn1r158 UTSW 7 22790224 missense probably benign 0.00
R7747:Vmn1r158 UTSW 7 22790300 missense probably benign 0.15
R7902:Vmn1r158 UTSW 7 22790008 missense possibly damaging 0.67
R8328:Vmn1r158 UTSW 7 22790062 missense probably damaging 1.00
R8400:Vmn1r158 UTSW 7 22789880 nonsense probably null
Z1177:Vmn1r158 UTSW 7 22790458 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TAGCGACTCTGATTTTCAACAGTTG -3'
(R):5'- CTTCTGGATTCAGTGTAGGCAC -3'

Sequencing Primer
(F):5'- TCAACAGTTGAAGAGCACAGAAC -3'
(R):5'- GTAGGCACTGTCCTCTTGCAG -3'
Posted On2018-06-22