Incidental Mutation 'R1813:Vmn1r158'
ID 202551
Institutional Source Beutler Lab
Gene Symbol Vmn1r158
Ensembl Gene ENSMUSG00000094700
Gene Name vomeronasal 1 receptor 158
Synonyms Gm16455
MMRRC Submission 039841-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.592) question?
Stock # R1813 (G1)
Quality Score 168
Status Not validated
Chromosome 7
Chromosomal Location 22489284-22490207 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 22490143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 22 (C22Y)
Ref Sequence ENSEMBL: ENSMUSP00000133990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174643]
AlphaFold G3UY92
Predicted Effect probably damaging
Transcript: ENSMUST00000174643
AA Change: C22Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133990
Gene: ENSMUSG00000094700
AA Change: C22Y

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 2.9e-15 PFAM
Pfam:7tm_1 39 290 5.5e-9 PFAM
Pfam:V1R 41 298 3.2e-17 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,543,236 (GRCm39) N595Y probably benign Het
Abca6 A G 11: 110,124,671 (GRCm39) probably benign Het
Abo C A 2: 26,733,609 (GRCm39) D199Y probably damaging Het
Acvr1c A C 2: 58,170,306 (GRCm39) V277G probably damaging Het
Adam23 G A 1: 63,584,731 (GRCm39) A380T probably benign Het
Art2b A G 7: 101,229,236 (GRCm39) V221A probably benign Het
Bcam A G 7: 19,500,640 (GRCm39) S153P probably damaging Het
Brip1 T C 11: 86,077,906 (GRCm39) H174R possibly damaging Het
Ccdc186 T C 19: 56,788,601 (GRCm39) D536G probably benign Het
Cd109 A G 9: 78,524,287 (GRCm39) N67S probably benign Het
Cd8a G T 6: 71,350,947 (GRCm39) M137I possibly damaging Het
Ces2g T C 8: 105,693,569 (GRCm39) F417L probably benign Het
Clec2g A G 6: 128,925,660 (GRCm39) N23S unknown Het
Cntnap2 T C 6: 46,507,567 (GRCm39) Y61C probably damaging Het
Cog3 T A 14: 75,979,784 (GRCm39) E182D probably benign Het
Dbpht2 A G 12: 74,342,624 (GRCm39) noncoding transcript Het
Dock4 A T 12: 40,686,227 (GRCm39) N154I probably damaging Het
Dysf T G 6: 84,128,906 (GRCm39) V1422G possibly damaging Het
E2f3 T C 13: 30,104,159 (GRCm39) D140G probably damaging Het
Efcab3 A G 11: 104,611,514 (GRCm39) K452R probably benign Het
Epb41l2 T A 10: 25,317,466 (GRCm39) probably null Het
Epha2 A G 4: 141,035,857 (GRCm39) K98E possibly damaging Het
Esyt1 T C 10: 128,355,487 (GRCm39) D444G probably benign Het
Fam163a T C 1: 155,955,787 (GRCm39) T2A probably damaging Het
Foxp2 A T 6: 15,379,767 (GRCm39) probably benign Het
Gcm2 T C 13: 41,259,367 (GRCm39) H34R probably benign Het
Gipr A G 7: 18,897,996 (GRCm39) S79P probably benign Het
Gli3 T C 13: 15,823,276 (GRCm39) S333P probably damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Gzmk A G 13: 113,309,427 (GRCm39) S208P probably damaging Het
Htra2 G T 6: 83,028,583 (GRCm39) A318D probably damaging Het
Itpkc T C 7: 26,907,805 (GRCm39) D633G probably damaging Het
Lama1 G A 17: 68,098,218 (GRCm39) R1805H probably benign Het
Lama4 T A 10: 38,909,121 (GRCm39) probably benign Het
Lama4 T C 10: 38,936,182 (GRCm39) V619A probably damaging Het
Notch3 T C 17: 32,362,402 (GRCm39) T1408A probably benign Het
Nwd2 A G 5: 63,962,753 (GRCm39) D779G probably benign Het
Nxpe4 A G 9: 48,304,678 (GRCm39) Y255C possibly damaging Het
Obox6 A T 7: 15,568,770 (GRCm39) H35Q possibly damaging Het
Or2ab1 A G 11: 58,489,133 (GRCm39) I304V probably damaging Het
Or8b41 T A 9: 38,055,025 (GRCm39) I198N possibly damaging Het
Pkig T A 2: 163,563,147 (GRCm39) I26N possibly damaging Het
Plekhm2 C T 4: 141,369,750 (GRCm39) V82M possibly damaging Het
Plppr2 G A 9: 21,859,220 (GRCm39) A446T probably damaging Het
Psme4 T A 11: 30,754,353 (GRCm39) F203L probably benign Het
Sh3bp1 A G 15: 78,787,880 (GRCm39) K137E probably damaging Het
Shisa5 T A 9: 108,885,108 (GRCm39) I126N probably damaging Het
Slc11a1 T C 1: 74,414,931 (GRCm39) L21P probably benign Het
Slc35f1 C T 10: 52,809,291 (GRCm39) P93S probably damaging Het
Slc4a4 A G 5: 89,194,167 (GRCm39) T172A probably damaging Het
Slc9c1 A T 16: 45,393,710 (GRCm39) Y551F probably benign Het
Spata31 T C 13: 65,069,612 (GRCm39) S587P probably benign Het
Syna C A 5: 134,588,006 (GRCm39) M314I probably benign Het
Taf5l A G 8: 124,730,152 (GRCm39) L144P probably damaging Het
Tbccd1 T C 16: 22,641,271 (GRCm39) T369A probably benign Het
Tnfrsf11b A T 15: 54,119,493 (GRCm39) C160* probably null Het
Trim45 A G 3: 100,830,283 (GRCm39) N19S probably benign Het
Uba2 A G 7: 33,850,455 (GRCm39) F364S probably damaging Het
Unc50 T A 1: 37,476,323 (GRCm39) L161Q probably damaging Het
Uso1 A T 5: 92,348,992 (GRCm39) probably null Het
Usp25 A G 16: 76,911,838 (GRCm39) I956V probably benign Het
Utf1 C A 7: 139,524,213 (GRCm39) L143I probably damaging Het
Vmn1r36 T A 6: 66,693,756 (GRCm39) M40L probably benign Het
Vmn2r43 A G 7: 8,258,055 (GRCm39) V386A possibly damaging Het
Vps9d1 C A 8: 123,973,778 (GRCm39) R335L probably damaging Het
Wasf1 T A 10: 40,802,585 (GRCm39) V80D probably damaging Het
Wdr72 G A 9: 74,183,298 (GRCm39) V1077I possibly damaging Het
Wnt8a A G 18: 34,675,422 (GRCm39) M1V probably null Het
Zbtb26 A G 2: 37,326,347 (GRCm39) S230P possibly damaging Het
Zfp335 A G 2: 164,734,525 (GRCm39) V1247A probably damaging Het
Zfp429 T C 13: 67,538,505 (GRCm39) N313S possibly damaging Het
Zfp74 A T 7: 29,634,569 (GRCm39) C380S probably damaging Het
Zfyve21 G A 12: 111,791,328 (GRCm39) E134K probably damaging Het
Zmynd11 T C 13: 9,739,616 (GRCm39) T474A possibly damaging Het
Other mutations in Vmn1r158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vmn1r158 APN 7 22,490,204 (GRCm39) missense probably benign 0.01
R1173:Vmn1r158 UTSW 7 22,489,870 (GRCm39) missense probably benign 0.19
R1574:Vmn1r158 UTSW 7 22,489,772 (GRCm39) missense probably damaging 1.00
R1574:Vmn1r158 UTSW 7 22,489,772 (GRCm39) missense probably damaging 1.00
R1725:Vmn1r158 UTSW 7 22,490,072 (GRCm39) missense probably benign 0.08
R1777:Vmn1r158 UTSW 7 22,489,855 (GRCm39) missense probably damaging 1.00
R1896:Vmn1r158 UTSW 7 22,490,143 (GRCm39) missense probably damaging 1.00
R2077:Vmn1r158 UTSW 7 22,489,815 (GRCm39) missense probably benign 0.03
R3749:Vmn1r158 UTSW 7 22,489,639 (GRCm39) missense probably damaging 1.00
R4872:Vmn1r158 UTSW 7 22,490,179 (GRCm39) missense possibly damaging 0.94
R5238:Vmn1r158 UTSW 7 22,489,799 (GRCm39) missense probably benign
R6500:Vmn1r158 UTSW 7 22,490,078 (GRCm39) missense possibly damaging 0.89
R6511:Vmn1r158 UTSW 7 22,490,116 (GRCm39) missense probably benign 0.00
R6581:Vmn1r158 UTSW 7 22,489,465 (GRCm39) missense possibly damaging 0.69
R6751:Vmn1r158 UTSW 7 22,489,306 (GRCm39) missense probably damaging 0.96
R7168:Vmn1r158 UTSW 7 22,490,101 (GRCm39) missense possibly damaging 0.82
R7337:Vmn1r158 UTSW 7 22,489,649 (GRCm39) missense probably benign 0.00
R7747:Vmn1r158 UTSW 7 22,489,725 (GRCm39) missense probably benign 0.15
R7902:Vmn1r158 UTSW 7 22,489,433 (GRCm39) missense possibly damaging 0.67
R8328:Vmn1r158 UTSW 7 22,489,487 (GRCm39) missense probably damaging 1.00
R8400:Vmn1r158 UTSW 7 22,489,305 (GRCm39) nonsense probably null
R8809:Vmn1r158 UTSW 7 22,489,775 (GRCm39) missense probably damaging 0.97
R9227:Vmn1r158 UTSW 7 22,489,469 (GRCm39) missense probably benign 0.02
R9468:Vmn1r158 UTSW 7 22,489,888 (GRCm39) missense probably damaging 1.00
R9702:Vmn1r158 UTSW 7 22,490,065 (GRCm39) missense probably benign 0.00
R9719:Vmn1r158 UTSW 7 22,489,331 (GRCm39) missense possibly damaging 0.95
Z1177:Vmn1r158 UTSW 7 22,489,883 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGGGAGCAAAAGCCATCATG -3'
(R):5'- CCCTGCAATTTACCTGTAATGTGTAAC -3'

Sequencing Primer
(F):5'- GAGCAAAAGCCATCATGTTGTTTGG -3'
(R):5'- CCACAGAGAGTAGTGTCCTA -3'
Posted On 2014-06-23