Incidental Mutation 'R6585:Ms4a14'
List |< first << previous [record 18 of 31] next >> last >|
ID524365
Institutional Source Beutler Lab
Gene Symbol Ms4a14
Ensembl Gene ENSMUSG00000099398
Gene Namemembrane-spanning 4-domains, subfamily A, member 14
SynonymsLOC383435
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11301249-11314454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11303645 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 516 (Q516H)
Ref Sequence ENSEMBL: ENSMUSP00000140996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187467]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181137
Predicted Effect unknown
Transcript: ENSMUST00000187467
AA Change: Q516H
SMART Domains Protein: ENSMUSP00000140996
Gene: ENSMUSG00000099398
AA Change: Q516H

DomainStartEndE-ValueType
Pfam:CD20 44 182 2.9e-27 PFAM
internal_repeat_2 356 466 2.78e-10 PROSPERO
internal_repeat_1 390 506 1.75e-17 PROSPERO
low complexity region 522 540 N/A INTRINSIC
low complexity region 625 640 N/A INTRINSIC
low complexity region 642 660 N/A INTRINSIC
internal_repeat_1 665 786 1.75e-17 PROSPERO
internal_repeat_2 700 811 2.78e-10 PROSPERO
low complexity region 911 936 N/A INTRINSIC
low complexity region 975 992 N/A INTRINSIC
low complexity region 1079 1092 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,737,668 C108Y probably damaging Het
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Ms4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Ms4a14 APN 19 11301619 missense possibly damaging 0.73
IGL03131:Ms4a14 APN 19 11307692 missense probably benign 0.01
IGL03136:Ms4a14 APN 19 11304411 missense possibly damaging 0.85
IGL03173:Ms4a14 APN 19 11304196 missense possibly damaging 0.86
IGL03210:Ms4a14 APN 19 11301961 missense possibly damaging 0.96
R0054:Ms4a14 UTSW 19 11303939 missense probably benign 0.00
R2895:Ms4a14 UTSW 19 11304231 missense possibly damaging 0.73
R4455:Ms4a14 UTSW 19 11303626 missense possibly damaging 0.53
R4574:Ms4a14 UTSW 19 11303971 missense probably benign
R4804:Ms4a14 UTSW 19 11304040 missense possibly damaging 0.73
R4815:Ms4a14 UTSW 19 11314277 missense probably benign 0.00
R4854:Ms4a14 UTSW 19 11310369 missense possibly damaging 0.51
R4858:Ms4a14 UTSW 19 11301612 missense probably benign 0.33
R5002:Ms4a14 UTSW 19 11304289 missense probably benign
R5382:Ms4a14 UTSW 19 11303057 missense possibly damaging 0.70
R5580:Ms4a14 UTSW 19 11303226 missense probably benign 0.33
R5626:Ms4a14 UTSW 19 11304055 missense probably benign
R5767:Ms4a14 UTSW 19 11302027 missense probably benign 0.18
R5801:Ms4a14 UTSW 19 11301786 missense possibly damaging 0.86
R5801:Ms4a14 UTSW 19 11301882 missense possibly damaging 0.73
R5865:Ms4a14 UTSW 19 11304217 missense possibly damaging 0.73
R5919:Ms4a14 UTSW 19 11314297 missense possibly damaging 0.86
R6261:Ms4a14 UTSW 19 11304020 missense probably benign 0.33
R6974:Ms4a14 UTSW 19 11302135 missense probably benign
R7401:Ms4a14 UTSW 19 11302230 missense possibly damaging 0.72
R7445:Ms4a14 UTSW 19 11302972 missense probably benign 0.00
R7489:Ms4a14 UTSW 19 11302031 missense probably benign 0.07
R7524:Ms4a14 UTSW 19 11303836 missense unknown
R7532:Ms4a14 UTSW 19 11303959 missense possibly damaging 0.86
R7689:Ms4a14 UTSW 19 11302542 missense probably benign 0.33
R7732:Ms4a14 UTSW 19 11301683 missense probably benign
R7737:Ms4a14 UTSW 19 11302786 nonsense probably null
R7860:Ms4a14 UTSW 19 11302944 missense probably benign
R8098:Ms4a14 UTSW 19 11304615 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GTGGAGTCACTTCAGATGGAG -3'
(R):5'- AAGAGACTCCATCCCAAGGG -3'

Sequencing Primer
(F):5'- TGGAGACACTTGGAGTGA -3'
(R):5'- GGGACTCCATACCAAGATCTAC -3'
Posted On2018-06-22