Incidental Mutation 'R6660:Fam71d'
List |< first << previous [record 12 of 33] next >> last >|
ID526814
Institutional Source Beutler Lab
Gene Symbol Fam71d
Ensembl Gene ENSMUSG00000056987
Gene Namefamily with sequence similarity 71, member D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location78691535-78734516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78715357 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 265 (V265A)
Ref Sequence ENSEMBL: ENSMUSP00000077119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077968] [ENSMUST00000219507] [ENSMUST00000219551] [ENSMUST00000220101] [ENSMUST00000220396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077968
AA Change: V265A

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077119
Gene: ENSMUSG00000056987
AA Change: V265A

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
Pfam:DUF3699 111 184 1.6e-25 PFAM
low complexity region 237 250 N/A INTRINSIC
low complexity region 265 284 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219507
Predicted Effect possibly damaging
Transcript: ENSMUST00000219551
AA Change: V265A

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219572
Predicted Effect probably benign
Transcript: ENSMUST00000220101
Predicted Effect probably benign
Transcript: ENSMUST00000220212
Predicted Effect probably benign
Transcript: ENSMUST00000220396
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Fam71d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02123:Fam71d APN 12 78734207 critical splice donor site probably null
IGL02738:Fam71d APN 12 78734215 splice site probably benign
R0760:Fam71d UTSW 12 78715153 missense probably damaging 1.00
R1832:Fam71d UTSW 12 78715506 unclassified probably benign
R1833:Fam71d UTSW 12 78715506 unclassified probably benign
R4335:Fam71d UTSW 12 78712232 missense possibly damaging 0.77
R4437:Fam71d UTSW 12 78715050 missense probably damaging 1.00
R4850:Fam71d UTSW 12 78715153 missense probably damaging 1.00
R5234:Fam71d UTSW 12 78715271 nonsense probably null
R5445:Fam71d UTSW 12 78715116 missense probably damaging 1.00
R5587:Fam71d UTSW 12 78715075 missense probably damaging 0.99
R5965:Fam71d UTSW 12 78710306 missense unknown
R5993:Fam71d UTSW 12 78715436 missense probably damaging 0.98
R6644:Fam71d UTSW 12 78715286 missense probably damaging 1.00
R7052:Fam71d UTSW 12 78719402 missense probably benign 0.00
R7098:Fam71d UTSW 12 78719634 critical splice donor site probably null
R7189:Fam71d UTSW 12 78712208 missense probably benign 0.22
R7305:Fam71d UTSW 12 78715035 missense possibly damaging 0.85
R7578:Fam71d UTSW 12 78715501 critical splice donor site probably null
R7604:Fam71d UTSW 12 78715014 missense probably damaging 1.00
R7720:Fam71d UTSW 12 78712133 missense probably damaging 1.00
R7786:Fam71d UTSW 12 78719629 missense probably benign 0.18
R8008:Fam71d UTSW 12 78715043 missense probably benign 0.33
U24488:Fam71d UTSW 12 78715037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGACATCACGGACATCAC -3'
(R):5'- TGTTAACAAAGACTTGGCTACAGC -3'

Sequencing Primer
(F):5'- ACTGCTTTCAGAGAACTGCG -3'
(R):5'- AGACTTGGCTACAGCTCCCATG -3'
Posted On2018-07-23