Incidental Mutation 'R6669:Ntn1'
ID528065
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Namenetrin 1
SynonymsNetrin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R6669 (G1)
Quality Score146.008
Status Validated
Chromosome11
Chromosomal Location68209364-68400823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68385750 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 124 (N124S)
Ref Sequence ENSEMBL: ENSMUSP00000121193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674] [ENSMUST00000135141]
Predicted Effect probably benign
Transcript: ENSMUST00000021284
AA Change: N124S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: N124S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108674
AA Change: N124S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: N124S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135141
AA Change: N124S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000121193
Gene: ENSMUSG00000020902
AA Change: N124S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 159 6.8e-15 SMART
Meta Mutation Damage Score 0.1679 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,840,373 I1952V probably benign Het
Atg2b T C 12: 105,671,529 E142G possibly damaging Het
Bbc3 G T 7: 16,313,716 A122S possibly damaging Het
Cenpu T C 8: 46,576,284 S191P probably damaging Het
Clic3 G T 2: 25,457,767 R48L possibly damaging Het
Cmya5 T C 13: 93,093,259 K1774E probably benign Het
Cnst T A 1: 179,605,073 probably null Het
Cyfip1 T A 7: 55,900,061 S657T probably damaging Het
Dock10 T C 1: 80,592,855 Y322C probably damaging Het
Epn2 C T 11: 61,519,558 V550I probably benign Het
Evc2 C T 5: 37,378,378 P466S possibly damaging Het
Fancd2 C T 6: 113,593,327 T1413I probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Herc4 T A 10: 63,286,068 W400R probably benign Het
Kcna7 T C 7: 45,409,564 V425A probably damaging Het
Klhl3 A T 13: 58,011,152 D564E probably benign Het
Man2b2 T C 5: 36,810,358 I889V probably benign Het
Mcm3ap A G 10: 76,507,337 I1688V probably damaging Het
Mocos T A 18: 24,666,410 F234I probably damaging Het
Muc20 T C 16: 32,793,937 T357A possibly damaging Het
Ncoa6 T G 2: 155,399,693 probably null Het
Nlk C A 11: 78,587,066 G284* probably null Het
Nrxn1 T A 17: 90,059,563 T12S probably damaging Het
Nrxn2 A G 19: 6,481,191 Y627C probably damaging Het
Pdzd7 T A 19: 45,036,751 Q435L possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc30a10 G A 1: 185,464,428 R429Q probably benign Het
Tox4 T C 14: 52,286,756 Y116H probably damaging Het
Trpv5 G A 6: 41,658,042 A451V probably damaging Het
Ube3a T C 7: 59,276,857 V482A probably benign Het
Vcan A T 13: 89,704,731 D703E probably benign Het
Xirp2 C A 2: 67,513,355 A1980E possibly damaging Het
Xrcc1 T C 7: 24,547,337 V10A probably damaging Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68226619 splice site probably benign
IGL00972:Ntn1 APN 11 68213272 missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68226604 missense probably benign 0.00
IGL01731:Ntn1 APN 11 68385418 missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68213263 missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68277530 missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68385469 missense probably benign 0.06
R0363:Ntn1 UTSW 11 68385543 missense probably benign 0.44
R1201:Ntn1 UTSW 11 68213226 missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68213133 small deletion probably benign
R1913:Ntn1 UTSW 11 68213185 missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68385294 missense probably benign 0.12
R2248:Ntn1 UTSW 11 68277572 missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68385612 missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68385864 missense probably benign 0.00
R3830:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68385910 missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68213026 small deletion probably benign
R4871:Ntn1 UTSW 11 68213026 small deletion probably benign
R4952:Ntn1 UTSW 11 68213026 small deletion probably benign
R5001:Ntn1 UTSW 11 68260532 missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68385712 missense probably benign 0.37
R6217:Ntn1 UTSW 11 68213332 missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68213199 missense probably damaging 1.00
R7172:Ntn1 UTSW 11 68385667 missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68386089 missense probably benign 0.15
R8314:Ntn1 UTSW 11 68385624 missense probably damaging 1.00
X0027:Ntn1 UTSW 11 68385636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCCGGTTGTACATTTTGC -3'
(R):5'- ACTTTGTCAACGCGGCCTTC -3'

Sequencing Primer
(F):5'- ACATTTTGCGGCACTGCG -3'
(R):5'- TTCGGCAAGGACGTGCG -3'
Posted On2018-07-24