Mutagenetix > Incidental Mutation

Incidental Mutation 'R6736:Notch1'

528380

Institutional Source

Beutler Lab

Gene Symbol

Notch1

Ensembl Gene

ENSMUSG00000026923

Gene Name

notch 1

Synonyms

Tan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6736 (G1)

Quality Score

165.009

Status

Not validated

Chromosome

Chromosomal Location

26457903-26516663 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26460286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2281 (T2281A)

Ref Sequence

ENSEMBL: ENSMUSP00000028288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028288]

AlphaFold

Q01705

PDB Structure

The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028288
AA Change: T2281A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: T2281A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EGF	23	58	1.63e1	SMART
EGF	62	99	4.29e-5	SMART
EGF	105	139	6.25e-7	SMART
EGF_CA	140	176	1.02e-6	SMART
EGF_CA	178	216	4.21e-13	SMART
EGF	221	255	6.7e-7	SMART
EGF_CA	257	293	6.8e-8	SMART
EGF_CA	295	333	1.16e-10	SMART
EGF_CA	335	371	3.17e-8	SMART
EGF	375	410	5.32e-1	SMART
EGF_CA	412	450	4.59e-14	SMART
EGF_CA	452	488	1.02e-11	SMART
EGF_CA	490	526	4.81e-8	SMART
EGF_CA	528	564	3.19e-13	SMART
EGF_CA	566	601	1.91e-11	SMART
EGF_CA	603	639	1.78e-11	SMART
EGF_CA	641	676	9.62e-8	SMART
EGF_CA	678	714	2.38e-12	SMART
EGF_CA	716	751	5.23e-9	SMART
EGF_CA	753	789	6.25e-7	SMART
EGF_CA	791	827	1.1e-11	SMART
EGF	832	867	2.03e-6	SMART
EGF_CA	869	905	5.73e-15	SMART
EGF_CA	907	943	4.56e-9	SMART
EGF_CA	945	981	1.64e-10	SMART
EGF_CA	983	1019	5.83e-7	SMART
EGF_CA	1021	1057	1.05e-13	SMART
EGF	1062	1095	8.12e-6	SMART
EGF	1100	1143	5.66e-5	SMART
EGF_CA	1145	1181	1.1e-11	SMART
EGF_CA	1183	1219	3.87e-12	SMART
EGF_CA	1221	1265	2.89e-11	SMART
EGF_CA	1267	1305	1.2e-8	SMART
EGF	1310	1346	5.74e-6	SMART
EGF	1351	1384	4.1e-2	SMART
EGF	1390	1426	2.66e-1	SMART
NL	1442	1480	4.08e-16	SMART
NL	1483	1522	1.08e-15	SMART
NL	1523	1562	7.39e-14	SMART
NOD	1566	1622	1.81e-32	SMART
NODP	1660	1722	3.27e-30	SMART
low complexity region	1729	1746	N/A	INTRINSIC
ANK	1870	1912	1.07e2	SMART
ANK	1917	1946	4.82e-3	SMART
ANK	1950	1980	6.71e-2	SMART
ANK	1984	2013	1.23e0	SMART
ANK	2017	2046	9.13e-4	SMART
ANK	2050	2079	2.97e-3	SMART
low complexity region	2205	2222	N/A	INTRINSIC
low complexity region	2364	2395	N/A	INTRINSIC
DUF3454	2453	2517	2.01e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132941

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133463

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139144

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151521

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156099

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 8,992,268	I83T	probably benign	Het
Aadacl4	T	G	4: 144,623,339	S389A	possibly damaging	Het
Abca13	A	T	11: 9,465,058	S4042C	probably damaging	Het
Acaca	G	A	11: 84,238,838	V340I	probably benign	Het
Acox3	T	A	5: 35,588,854		probably null	Het
Acsl6	A	C	11: 54,325,166	E124A	probably damaging	Het
Adamtsl1	T	A	4: 86,342,247	H898Q	probably damaging	Het
Agl	A	G	3: 116,781,680	S603P	probably damaging	Het
Apobec1	A	T	6: 122,581,675	M31K	probably null	Het
Armc4	C	A	18: 7,223,586	V486F	probably damaging	Het
Astn1	T	C	1: 158,511,148		probably null	Het
Atp8a1	G	T	5: 67,667,617	D790E	probably damaging	Het
Bahd1	T	G	2: 118,915,975	M25R	possibly damaging	Het
BC034090	A	T	1: 155,241,930	N147K	possibly damaging	Het
Bfsp2	G	T	9: 103,480,204	A8E	possibly damaging	Het
Brwd1	A	T	16: 96,068,572	I85N	probably damaging	Het
Ccdc24	T	A	4: 117,870,535	N145I	possibly damaging	Het
Cdhr5	G	T	7: 141,272,531	Q141K	probably damaging	Het
Cfap46	A	G	7: 139,619,971	V1998A	possibly damaging	Het
Csmd1	T	A	8: 16,002,626	Y2166F	probably damaging	Het
Cul4a	T	G	8: 13,136,219	S474A	probably benign	Het
Cutal	A	G	2: 34,888,137	T112A	probably benign	Het
Dcaf6	A	C	1: 165,399,785	S258A	possibly damaging	Het
Dek	C	T	13: 47,099,390	V180M	probably damaging	Het
Dspp	C	A	5: 104,178,175	D801E	unknown	Het
Egflam	T	C	15: 7,219,725	T871A	probably damaging	Het
Erbin	A	T	13: 103,834,766	S781T	possibly damaging	Het
Erich6	A	T	3: 58,625,054	H377Q	probably damaging	Het
Exo5	C	A	4: 120,921,756	G304V	probably damaging	Het
Eya2	C	A	2: 165,716,037	S184R	possibly damaging	Het
Fhod1	G	A	8: 105,337,890		probably benign	Het
G6pc3	A	G	11: 102,193,670	Y302C	possibly damaging	Het
Gart	T	C	16: 91,636,107	D318G	probably benign	Het
Gm10300	T	C	4: 132,074,935		probably benign	Het
Gm11937	A	G	11: 99,610,074	V39A	probably damaging	Het
Gm16432	T	A	1: 178,017,712	Y99*	probably null	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gnas	T	C	2: 174,334,251	M60T	probably damaging	Het
Grk5	G	T	19: 60,890,626	R16L	probably damaging	Het
Hcn3	A	G	3: 89,152,674	L221P	probably damaging	Het
Hddc3	G	A	7: 80,343,196	R20Q	possibly damaging	Het
Hectd4	T	C	5: 121,277,725	Y530H	possibly damaging	Het
Igf2bp1	A	T	11: 95,973,122	H247Q	probably benign	Het
Igkv4-70	T	A	6: 69,267,928	D103V	probably damaging	Het
Itpr2	T	A	6: 146,325,170	M1359L	probably damaging	Het
Kalrn	A	G	16: 34,217,923	L1013S	probably damaging	Het
Kctd21	C	T	7: 97,348,084	R255W	probably damaging	Het
Krt18	T	A	15: 102,030,769	Y263N	probably benign	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Larp1	G	A	11: 58,042,647		probably null	Het
Lmnb1	A	G	18: 56,728,469	N144S	probably damaging	Het
Lrp2	T	A	2: 69,448,211	T3933S	probably benign	Het
Lrrc34	T	C	3: 30,624,859	N363S	probably benign	Het
Lrriq1	T	C	10: 103,181,889		probably null	Het
Mafa	C	A	15: 75,747,780	G48V	unknown	Het
Mboat4	T	C	8: 34,124,521	S371P	possibly damaging	Het
Mei4	A	T	9: 82,025,624	M237L	probably benign	Het
Mfsd2a	T	C	4: 122,951,261	D219G	probably benign	Het
Msl2	A	G	9: 101,101,002	N192D	probably damaging	Het
Mycbp2	C	A	14: 103,191,567	R2358M	probably null	Het
Myh10	A	G	11: 68,745,339	T185A	probably damaging	Het
Nipsnap2	T	C	5: 129,745,288		probably null	Het
Olfr1165-ps	C	A	2: 88,101,603	C128F	probably benign	Het
Olfr1436	G	A	19: 12,298,572	Q187*	probably null	Het
Olfr376	G	T	11: 73,375,576	V276F	probably benign	Het
Olfr533	T	C	7: 140,466,887	S229P	probably damaging	Het
Olfr533	G	T	7: 140,466,921	C240F	probably damaging	Het
Olfr735	A	T	14: 50,345,448	N300K	probably damaging	Het
Olfr895	T	A	9: 38,268,570	I19N	probably damaging	Het
Olfr948	A	G	9: 39,318,793	S274P	probably damaging	Het
Oxct1	T	A	15: 4,092,417	S283T	probably benign	Het
Pcnx2	G	T	8: 125,752,317		probably null	Het
Piwil4	A	G	9: 14,715,823	F424L	probably benign	Het
Pkhd1l1	T	C	15: 44,557,940	S3035P	probably damaging	Het
Psmc2	T	A	5: 21,800,576	D218E	probably damaging	Het
Ptpn7	C	T	1: 135,139,236	P277L	probably benign	Het
Rgs12	A	G	5: 35,023,092	K27E	probably damaging	Het
Rp1l1	G	T	14: 64,029,724	A920S	possibly damaging	Het
Rsbn1l	A	T	5: 20,908,224	H433Q	probably benign	Het
Safb	C	A	17: 56,606,023	P913Q	possibly damaging	Het
Sema7a	G	A	9: 57,960,571	V477M	probably damaging	Het
Serpina16	T	A	12: 103,668,932	T408S	possibly damaging	Het
Six5	G	A	7: 19,094,991	V119M	possibly damaging	Het
Slc6a16	C	T	7: 45,259,028	P11S	possibly damaging	Het
Smg1	A	G	7: 118,157,166		probably benign	Het
Sntg1	T	A	1: 8,445,050	I420F	probably benign	Het
Sptb	T	C	12: 76,613,180	D982G	possibly damaging	Het
Stag3	T	A	5: 138,301,499	F891I	probably damaging	Het
Sugp1	A	G	8: 70,059,303	E183G	probably benign	Het
Taf1d	T	C	9: 15,307,823		probably null	Het
Tapbp	T	C	17: 33,919,957	S33P	possibly damaging	Het
Ubap2	GCCCGCTTGCCCCGCT	GCCCGCTTGCCCCGCTTGCCCCGCT	4: 41,227,210		probably benign	Het
Ubap2	CT	CTTGCCCCGGT	4: 41,227,224		probably benign	Het
Ubash3a	A	G	17: 31,231,415	T355A	probably benign	Het
Usp16	T	G	16: 87,470,397	V225G	probably damaging	Het
Utrn	A	G	10: 12,621,303	V2454A	probably benign	Het
Vmn1r191	G	T	13: 22,179,550	F11L	probably benign	Het
Vmn2r117	A	T	17: 23,478,308	C137S	probably damaging	Het
Zfp143	T	C	7: 110,091,814	M524T	probably damaging	Het
Zfp599	A	G	9: 22,249,844	C342R	probably damaging	Het
Zfp777	T	G	6: 48,024,856	K811Q	probably damaging	Het
Zfp870	T	A	17: 32,883,596	H254L	probably benign	Het

Other mutations in Notch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Notch1	APN	2	26460046	missense	probably damaging	0.98
IGL01343:Notch1	APN	2	26472905	missense	probably benign	0.25
IGL02066:Notch1	APN	2	26460396	missense	possibly damaging	0.71
IGL02158:Notch1	APN	2	26460339	missense	probably damaging	1.00
IGL02541:Notch1	APN	2	26468503	missense	probably benign	0.12
IGL03280:Notch1	APN	2	26477874	intron	probably benign
IGL03338:Notch1	APN	2	26459959	missense	probably benign
Antero	UTSW	2	26476114	missense	possibly damaging	0.96
march	UTSW	2	26469899	missense	probably damaging	0.98
PIT4494001:Notch1	UTSW	2	26466473	missense	probably damaging	1.00
R0013:Notch1	UTSW	2	26473818	missense	possibly damaging	0.64
R0025:Notch1	UTSW	2	26470931	missense	probably damaging	1.00
R0129:Notch1	UTSW	2	26460458	missense	probably benign	0.06
R0285:Notch1	UTSW	2	26460861	missense	possibly damaging	0.88
R0531:Notch1	UTSW	2	26466572	missense	probably benign	0.00
R0747:Notch1	UTSW	2	26472140	missense	unknown
R1440:Notch1	UTSW	2	26480964	intron	probably benign
R1502:Notch1	UTSW	2	26484323	missense	possibly damaging	0.95
R1539:Notch1	UTSW	2	26472113	nonsense	probably null
R1623:Notch1	UTSW	2	26478612	missense	possibly damaging	0.88
R1844:Notch1	UTSW	2	26460434	missense	probably benign	0.12
R1863:Notch1	UTSW	2	26469950	missense	probably damaging	1.00
R1874:Notch1	UTSW	2	26481579	missense	possibly damaging	0.89
R1926:Notch1	UTSW	2	26481657	missense	probably damaging	1.00
R2156:Notch1	UTSW	2	26460861	missense	possibly damaging	0.91
R2196:Notch1	UTSW	2	26463804	nonsense	probably null
R2209:Notch1	UTSW	2	26460007	missense	probably benign
R2382:Notch1	UTSW	2	26473781	missense	probably benign	0.40
R2508:Notch1	UTSW	2	26465473	missense	possibly damaging	0.80
R2873:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R2874:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R3798:Notch1	UTSW	2	26478618	missense	probably benign	0.00
R4019:Notch1	UTSW	2	26481142	missense	probably benign	0.03
R4305:Notch1	UTSW	2	26477924	missense	probably damaging	1.00
R4334:Notch1	UTSW	2	26460036	missense	probably benign	0.22
R4504:Notch1	UTSW	2	26472177	missense	probably benign	0.16
R4624:Notch1	UTSW	2	26478081	missense	possibly damaging	0.94
R4659:Notch1	UTSW	2	26470889	missense	probably damaging	0.99
R4703:Notch1	UTSW	2	26471158	missense	probably benign
R4869:Notch1	UTSW	2	26471179	missense	probably benign	0.21
R4938:Notch1	UTSW	2	26474124	nonsense	probably null
R4989:Notch1	UTSW	2	26481181	missense	probably damaging	1.00
R5010:Notch1	UTSW	2	26476114	missense	possibly damaging	0.96
R5283:Notch1	UTSW	2	26468626	missense	probably damaging	1.00
R5303:Notch1	UTSW	2	26478619	missense	probably benign	0.01
R5635:Notch1	UTSW	2	26476161	missense	probably damaging	1.00
R5755:Notch1	UTSW	2	26473692	missense	probably benign	0.12
R5926:Notch1	UTSW	2	26476104	missense	probably benign	0.35
R5947:Notch1	UTSW	2	26462528	intron	probably benign
R6053:Notch1	UTSW	2	26472912	missense	probably benign	0.06
R6161:Notch1	UTSW	2	26468731	missense	probably damaging	1.00
R6162:Notch1	UTSW	2	26462195	missense	probably benign
R6174:Notch1	UTSW	2	26485442	missense	possibly damaging	0.50
R6199:Notch1	UTSW	2	26469899	missense	probably damaging	0.98
R6209:Notch1	UTSW	2	26472805	missense	probably damaging	1.00
R6251:Notch1	UTSW	2	26474170	missense	possibly damaging	0.64
R6493:Notch1	UTSW	2	26472098	missense	unknown
R6723:Notch1	UTSW	2	26478106	missense	probably damaging	1.00
R7020:Notch1	UTSW	2	26481574	missense	possibly damaging	0.95
R7058:Notch1	UTSW	2	26463818	missense	probably benign	0.05
R7154:Notch1	UTSW	2	26459938	missense	probably benign
R7291:Notch1	UTSW	2	26476375	missense	probably benign	0.01
R7379:Notch1	UTSW	2	26479467	missense	probably damaging	1.00
R7560:Notch1	UTSW	2	26460165	missense	probably benign	0.43
R7610:Notch1	UTSW	2	26478179	missense	probably benign	0.13
R7833:Notch1	UTSW	2	26459533	makesense	probably null
R7988:Notch1	UTSW	2	26471001	missense	probably benign	0.00
R8493:Notch1	UTSW	2	26472239	missense	unknown
R8514:Notch1	UTSW	2	26472169	missense	probably damaging	1.00
R8523:Notch1	UTSW	2	26464905	missense	possibly damaging	0.82
R8677:Notch1	UTSW	2	26469924	missense	probably damaging	1.00
R8696:Notch1	UTSW	2	26477992	critical splice acceptor site	probably benign
R8833:Notch1	UTSW	2	26481603	missense	probably damaging	1.00
R8964:Notch1	UTSW	2	26481050	missense	possibly damaging	0.65
R9091:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
R9144:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9145:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9151:Notch1	UTSW	2	26477927	missense	probably benign	0.01
R9270:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
R9463:Notch1	UTSW	2	26469833	missense	probably benign	0.20
R9546:Notch1	UTSW	2	26481115	missense	probably damaging	0.97
R9674:Notch1	UTSW	2	26471296	missense	probably damaging	0.98
X0018:Notch1	UTSW	2	26462227	nonsense	probably null
X0066:Notch1	UTSW	2	26470335	missense	possibly damaging	0.90
Z1088:Notch1	UTSW	2	26477115	missense	probably damaging	0.99
Z1177:Notch1	UTSW	2	26460309	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- ATCATGCTATGCTGGAGGCC -3'
(R):5'- ACTTGTCAGATGTGGCCTC -3'

Sequencing Primer
(F):5'- CAGCTGCCTGTGTGCTCAG -3'
(R):5'- AGCAGTCTCCATCCATGCC -3'

Posted On

2018-07-24