Incidental Mutation 'R6622:Cep170'
ID 524487
Institutional Source Beutler Lab
Gene Symbol Cep170
Ensembl Gene ENSMUSG00000057335
Gene Name centrosomal protein 170
Synonyms A330004A13Rik, 4933426L22Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.728) question?
Stock # R6622 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 176561219-176641633 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 176583898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 827 (Q827L)
Ref Sequence ENSEMBL: ENSMUSP00000141769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057037] [ENSMUST00000192927] [ENSMUST00000194727] [ENSMUST00000195717] [ENSMUST00000195433]
AlphaFold Q6A065
Predicted Effect probably damaging
Transcript: ENSMUST00000057037
AA Change: Q827L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059562
Gene: ENSMUSG00000057335
AA Change: Q827L

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 801 1496 3.3e-264 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192664
Predicted Effect probably damaging
Transcript: ENSMUST00000192927
AA Change: Q62L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142032
Gene: ENSMUSG00000057335
AA Change: Q62L

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:CEP170_C 30 469 3.4e-129 PFAM
Pfam:CEP170_C 449 708 7.4e-102 PFAM
low complexity region 742 754 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194727
AA Change: Q827L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141793
Gene: ENSMUSG00000057335
AA Change: Q827L

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1509 8e-260 PFAM
low complexity region 1543 1555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195121
Predicted Effect probably damaging
Transcript: ENSMUST00000195717
AA Change: Q827L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141769
Gene: ENSMUSG00000057335
AA Change: Q827L

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1499 1.8e-261 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195433
SMART Domains Protein: ENSMUSP00000142108
Gene: ENSMUSG00000057335

DomainStartEndE-ValueType
FHA 22 73 6.1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195463
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. During interphase, the encoded protein localizes to the sub-distal appendages of mature centrioles, which are microtubule-based structures thought to help organize centrosomes. During mitosis, the protein associates with spindle microtubules near the centrosomes. The protein interacts with and is phosphorylated by polo-like kinase 1, and functions in maintaining microtubule organization and cell morphology. The human genome contains a putative transcribed pseudogene. Several alternatively spliced transcript variants of this gene have been found, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(29) : Gene trapped(29)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A C 5: 81,942,606 (GRCm39) D1412A probably benign Het
Arhgap26 A G 18: 39,032,916 (GRCm39) probably benign Het
Card14 A G 11: 119,224,814 (GRCm39) M614V probably benign Het
Cbx2 A G 11: 118,919,961 (GRCm39) T509A probably damaging Het
Cep135 A G 5: 76,788,815 (GRCm39) D1136G probably benign Het
Clock A T 5: 76,389,801 (GRCm39) I349K probably damaging Het
Cnppd1 A T 1: 75,113,539 (GRCm39) V243E probably damaging Het
Cops3 A G 11: 59,723,960 (GRCm39) F93L probably damaging Het
Cplane1 C A 15: 8,273,706 (GRCm39) A2563D probably damaging Het
Cxxc5 T G 18: 35,992,372 (GRCm39) C258G possibly damaging Het
Cycs G A 6: 50,543,443 (GRCm39) probably benign Het
Cyp2c40 A T 19: 39,790,990 (GRCm39) H280Q probably damaging Het
Cyp4f14 C T 17: 33,133,619 (GRCm39) R79H probably benign Het
Dnajc27 A G 12: 4,153,114 (GRCm39) S197G probably benign Het
Dscam C T 16: 96,446,273 (GRCm39) G1456E probably benign Het
Dst G A 1: 34,218,332 (GRCm39) V1591I probably benign Het
Epha5 A G 5: 84,385,387 (GRCm39) S315P possibly damaging Het
Frmd4a A G 2: 4,610,873 (GRCm39) T1012A probably benign Het
Fxr2 G A 11: 69,532,416 (GRCm39) probably null Het
Hcn4 T A 9: 58,765,010 (GRCm39) V534E unknown Het
Hrh4 A G 18: 13,155,454 (GRCm39) Y331C probably damaging Het
Insyn1 A G 9: 58,406,533 (GRCm39) I148V probably benign Het
Kif16b T A 2: 142,554,362 (GRCm39) H812L probably benign Het
Krt14 T A 11: 100,094,786 (GRCm39) R451S probably benign Het
Man2b1 A G 8: 85,811,108 (GRCm39) T80A probably damaging Het
Nedd4l A G 18: 65,307,305 (GRCm39) T383A probably damaging Het
Pcdha9 T A 18: 37,131,707 (GRCm39) L259M possibly damaging Het
Pdgfd T C 9: 6,293,818 (GRCm39) C131R probably damaging Het
Prrc2a C G 17: 35,374,396 (GRCm39) R1418P probably damaging Het
Ptpra G T 2: 30,327,589 (GRCm39) E114D probably damaging Het
Ptprt A T 2: 161,395,760 (GRCm39) C1157S probably damaging Het
Rnf126 A T 10: 79,597,397 (GRCm39) probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sel1l3 A G 5: 53,297,202 (GRCm39) V748A probably damaging Het
Serinc5 T A 13: 92,825,194 (GRCm39) S208T probably benign Het
Sftpb A G 6: 72,282,639 (GRCm39) I74V possibly damaging Het
Slc22a14 A C 9: 118,999,643 (GRCm39) I516S possibly damaging Het
Slco2a1 G A 9: 102,951,704 (GRCm39) C411Y possibly damaging Het
Spata31f1e T A 4: 42,793,111 (GRCm39) L340F probably damaging Het
Tent5a G T 9: 85,208,509 (GRCm39) R105S probably damaging Het
Tet3 G A 6: 83,380,426 (GRCm39) P581S probably benign Het
Tmem231 T C 8: 112,645,563 (GRCm39) D112G probably damaging Het
Tnrc6b T A 15: 80,763,385 (GRCm39) W296R probably damaging Het
Trpm1 T A 7: 63,890,343 (GRCm39) L982H probably damaging Het
Ttn C A 2: 76,550,862 (GRCm39) R23183I possibly damaging Het
Tuft1 T A 3: 94,542,726 (GRCm39) Y46F probably damaging Het
Vmn1r167 T A 7: 23,205,014 (GRCm39) M1L probably null Het
Zfp808 A G 13: 62,319,646 (GRCm39) R292G possibly damaging Het
Zp2 T C 7: 119,731,748 (GRCm39) E669G probably benign Het
Zp2 C T 7: 119,741,136 (GRCm39) M129I probably benign Het
Other mutations in Cep170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cep170 APN 1 176,582,965 (GRCm39) missense probably damaging 1.00
IGL00925:Cep170 APN 1 176,621,090 (GRCm39) missense probably damaging 1.00
IGL00972:Cep170 APN 1 176,563,262 (GRCm39) missense probably benign 0.00
IGL01488:Cep170 APN 1 176,583,941 (GRCm39) missense probably benign 0.00
IGL01916:Cep170 APN 1 176,567,476 (GRCm39) splice site probably benign
IGL02212:Cep170 APN 1 176,563,502 (GRCm39) missense probably damaging 0.99
IGL02269:Cep170 APN 1 176,596,932 (GRCm39) missense probably benign
IGL02732:Cep170 APN 1 176,564,440 (GRCm39) missense probably damaging 1.00
IGL02740:Cep170 APN 1 176,621,166 (GRCm39) missense probably damaging 1.00
IGL02812:Cep170 APN 1 176,570,080 (GRCm39) missense probably damaging 1.00
IGL03036:Cep170 APN 1 176,596,903 (GRCm39) missense possibly damaging 0.87
IGL03201:Cep170 APN 1 176,564,454 (GRCm39) missense probably damaging 1.00
IGL03333:Cep170 APN 1 176,597,092 (GRCm39) missense possibly damaging 0.64
BB003:Cep170 UTSW 1 176,588,979 (GRCm39) missense probably damaging 0.97
BB013:Cep170 UTSW 1 176,588,979 (GRCm39) missense probably damaging 0.97
PIT4520001:Cep170 UTSW 1 176,607,765 (GRCm39) missense unknown
R0031:Cep170 UTSW 1 176,583,657 (GRCm39) missense probably damaging 1.00
R0039:Cep170 UTSW 1 176,610,061 (GRCm39) critical splice donor site probably null
R0053:Cep170 UTSW 1 176,609,946 (GRCm39) missense possibly damaging 0.82
R0053:Cep170 UTSW 1 176,609,946 (GRCm39) missense possibly damaging 0.82
R0113:Cep170 UTSW 1 176,586,021 (GRCm39) missense probably damaging 0.97
R0144:Cep170 UTSW 1 176,620,161 (GRCm39) missense probably benign 0.01
R0613:Cep170 UTSW 1 176,602,246 (GRCm39) missense probably benign
R0755:Cep170 UTSW 1 176,583,319 (GRCm39) missense probably damaging 1.00
R1132:Cep170 UTSW 1 176,577,603 (GRCm39) missense probably damaging 1.00
R1367:Cep170 UTSW 1 176,563,290 (GRCm39) missense probably damaging 0.99
R1399:Cep170 UTSW 1 176,585,969 (GRCm39) missense probably damaging 0.98
R1462:Cep170 UTSW 1 176,584,211 (GRCm39) missense possibly damaging 0.46
R1462:Cep170 UTSW 1 176,584,211 (GRCm39) missense possibly damaging 0.46
R1481:Cep170 UTSW 1 176,609,951 (GRCm39) missense possibly damaging 0.56
R1526:Cep170 UTSW 1 176,616,071 (GRCm39) missense probably damaging 1.00
R1540:Cep170 UTSW 1 176,567,498 (GRCm39) missense probably damaging 1.00
R1552:Cep170 UTSW 1 176,610,060 (GRCm39) splice site probably benign
R1570:Cep170 UTSW 1 176,583,367 (GRCm39) missense possibly damaging 0.64
R1846:Cep170 UTSW 1 176,583,335 (GRCm39) missense probably damaging 1.00
R1884:Cep170 UTSW 1 176,602,245 (GRCm39) missense probably benign 0.12
R1945:Cep170 UTSW 1 176,621,100 (GRCm39) nonsense probably null
R1954:Cep170 UTSW 1 176,583,950 (GRCm39) missense probably benign
R1957:Cep170 UTSW 1 176,597,013 (GRCm39) missense probably benign 0.24
R2184:Cep170 UTSW 1 176,584,542 (GRCm39) missense probably benign 0.00
R2280:Cep170 UTSW 1 176,602,071 (GRCm39) missense probably benign 0.17
R2426:Cep170 UTSW 1 176,602,201 (GRCm39) missense probably benign
R3415:Cep170 UTSW 1 176,583,610 (GRCm39) missense probably damaging 1.00
R3417:Cep170 UTSW 1 176,583,610 (GRCm39) missense probably damaging 1.00
R3752:Cep170 UTSW 1 176,610,061 (GRCm39) critical splice donor site probably benign
R3848:Cep170 UTSW 1 176,583,409 (GRCm39) missense probably benign 0.14
R3849:Cep170 UTSW 1 176,583,409 (GRCm39) missense probably benign 0.14
R4752:Cep170 UTSW 1 176,584,254 (GRCm39) missense probably benign 0.00
R4910:Cep170 UTSW 1 176,609,829 (GRCm39) missense possibly damaging 0.94
R5007:Cep170 UTSW 1 176,597,380 (GRCm39) missense probably benign 0.28
R5052:Cep170 UTSW 1 176,621,117 (GRCm39) missense probably damaging 1.00
R5093:Cep170 UTSW 1 176,596,896 (GRCm39) missense possibly damaging 0.95
R5530:Cep170 UTSW 1 176,597,076 (GRCm39) missense probably benign 0.00
R5622:Cep170 UTSW 1 176,563,433 (GRCm39) missense possibly damaging 0.64
R5892:Cep170 UTSW 1 176,582,953 (GRCm39) splice site probably null
R5942:Cep170 UTSW 1 176,583,985 (GRCm39) missense probably damaging 1.00
R6083:Cep170 UTSW 1 176,602,191 (GRCm39) missense probably damaging 1.00
R6091:Cep170 UTSW 1 176,583,397 (GRCm39) missense probably damaging 0.98
R6190:Cep170 UTSW 1 176,609,975 (GRCm39) missense probably damaging 1.00
R6253:Cep170 UTSW 1 176,607,960 (GRCm39) missense possibly damaging 0.71
R6476:Cep170 UTSW 1 176,607,917 (GRCm39) missense possibly damaging 0.72
R6932:Cep170 UTSW 1 176,589,003 (GRCm39) missense possibly damaging 0.90
R7030:Cep170 UTSW 1 176,584,051 (GRCm39) missense probably damaging 0.99
R7163:Cep170 UTSW 1 176,602,031 (GRCm39) missense probably damaging 1.00
R7352:Cep170 UTSW 1 176,597,423 (GRCm39) missense probably benign 0.11
R7499:Cep170 UTSW 1 176,602,028 (GRCm39) missense probably damaging 1.00
R7502:Cep170 UTSW 1 176,583,595 (GRCm39) missense probably damaging 1.00
R7773:Cep170 UTSW 1 176,567,642 (GRCm39) missense
R7926:Cep170 UTSW 1 176,588,979 (GRCm39) missense probably damaging 0.97
R8043:Cep170 UTSW 1 176,596,808 (GRCm39) missense probably damaging 0.96
R8203:Cep170 UTSW 1 176,596,877 (GRCm39) missense probably benign 0.28
R8350:Cep170 UTSW 1 176,564,445 (GRCm39) missense
R8450:Cep170 UTSW 1 176,564,445 (GRCm39) missense
R8835:Cep170 UTSW 1 176,584,429 (GRCm39) missense probably benign 0.00
R8931:Cep170 UTSW 1 176,597,377 (GRCm39) missense probably benign 0.02
R9108:Cep170 UTSW 1 176,616,051 (GRCm39) nonsense probably null
R9323:Cep170 UTSW 1 176,586,068 (GRCm39) missense probably benign
R9586:Cep170 UTSW 1 176,563,463 (GRCm39) missense possibly damaging 0.88
R9629:Cep170 UTSW 1 176,583,821 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCAAGGTTGTGTCCATGCTAG -3'
(R):5'- CCAGTGGACTCCTACTAAGTTTC -3'

Sequencing Primer
(F):5'- CAAGGTTGTGTCCATGCTAGAATCAG -3'
(R):5'- TAAATGTAGGGAGGAATCTTCTAAGC -3'
Posted On 2018-06-22