Incidental Mutation 'R0607:Ankhd1'
ID54357
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Synonyms
MMRRC Submission 038796-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0607 (G1)
Quality Score206
Status Not validated
Chromosome18
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36640280 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 59 (V59F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect probably damaging
Transcript: ENSMUST00000006205
AA Change: V1377F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: V1377F

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037072
SMART Domains Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
KH 183 253 5.04e-13 SMART
low complexity region 458 491 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
low complexity region 824 836 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130035
AA Change: V79F

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117110
Gene: ENSMUSG00000024483
AA Change: V79F

DomainStartEndE-ValueType
ANK 2 26 5.35e2 SMART
ANK 30 59 9.41e-6 SMART
ANK 63 96 3.8e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142977
AA Change: V1377F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: V1377F

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152940
Predicted Effect probably damaging
Transcript: ENSMUST00000153612
AA Change: V59F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116462
Gene: ENSMUSG00000024483
AA Change: V59F

DomainStartEndE-ValueType
ANK 10 39 9.41e-6 SMART
ANK 43 76 3.8e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155329
AA Change: V1377F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: V1377F

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 147 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,554,698 E146G probably benign Het
4930435E12Rik A C 16: 38,828,364 S128A probably benign Het
Abca4 G A 3: 122,156,432 G594S probably damaging Het
Acacb T C 5: 114,200,301 Y726H probably damaging Het
Adam20 T A 8: 40,795,480 M209K probably benign Het
Adam29 A G 8: 55,873,275 V48A probably damaging Het
Adss A G 1: 177,767,687 V429A possibly damaging Het
Aff1 T C 5: 103,828,454 S481P probably damaging Het
Akr1c19 G A 13: 4,238,460 A146T probably benign Het
Ankmy1 T G 1: 92,888,675 Y239S probably damaging Het
Ankrd24 G T 10: 81,638,308 C19F probably damaging Het
Apaf1 T C 10: 91,009,203 H1002R probably damaging Het
Apc2 T C 10: 80,314,101 I1663T probably benign Het
Apcdd1 A G 18: 62,951,896 N388S possibly damaging Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Armc2 T A 10: 41,922,695 H706L probably benign Het
Arrb1 T C 7: 99,588,196 probably null Het
Atl3 T C 19: 7,529,666 probably null Het
B9d2 A G 7: 25,683,332 T44A probably damaging Het
Btbd3 C T 2: 138,283,816 R307W possibly damaging Het
C1galt1 T C 6: 7,871,193 I343T probably benign Het
Cacna1a A G 8: 84,629,831 D1901G probably damaging Het
Ccdc42 C T 11: 68,597,710 Q312* probably null Het
Cdh18 T C 15: 23,410,790 Y454H probably benign Het
Celf5 G A 10: 81,466,005 T317I probably damaging Het
Celsr2 A T 3: 108,403,895 probably null Het
Cenpf A T 1: 189,682,463 probably null Het
Cep350 T C 1: 155,872,048 D2042G probably damaging Het
Chd3 T C 11: 69,344,358 D2054G probably damaging Het
Chgb A G 2: 132,793,335 H399R probably benign Het
Clp1 C T 2: 84,725,591 A182T possibly damaging Het
Col15a1 A G 4: 47,282,654 N777S probably damaging Het
Coq6 A G 12: 84,368,638 D145G possibly damaging Het
Csf2rb2 T C 15: 78,287,908 Y325C probably benign Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cyp4x1 T A 4: 115,112,826 D368V probably damaging Het
D10Wsu102e T C 10: 83,362,097 S56P probably benign Het
D430041D05Rik C T 2: 104,233,445 R1354H probably damaging Het
D6Ertd527e A C 6: 87,111,905 D350A unknown Het
Ddx24 A G 12: 103,419,067 Y426H possibly damaging Het
Dexi G T 16: 10,542,562 Y43* probably null Het
Dgka A G 10: 128,720,469 probably null Het
Dhx38 A T 8: 109,558,943 D419E probably benign Het
Dlg1 C A 16: 31,665,580 Q9K probably benign Het
Dlg1 G A 16: 31,838,174 V596I possibly damaging Het
Dnah11 A C 12: 118,082,511 W1731G probably damaging Het
Dnhd1 T A 7: 105,720,788 N4473K probably benign Het
Dync2h1 A C 9: 7,051,480 S3152A probably benign Het
Egfl7 C T 2: 26,589,440 T68I probably damaging Het
Eif2a G A 3: 58,555,652 probably null Het
Emb G A 13: 117,232,750 V56I possibly damaging Het
Enpp4 A T 17: 44,099,495 C397S probably damaging Het
Entpd3 A G 9: 120,557,405 T151A possibly damaging Het
Ero1lb A G 13: 12,574,866 D50G probably damaging Het
Fam219a A G 4: 41,520,242 *169Q probably null Het
Fga G A 3: 83,028,562 G32E probably damaging Het
Fkbpl T C 17: 34,645,359 F34L probably benign Het
Fsd2 T A 7: 81,545,017 D466V probably damaging Het
Gja1 A G 10: 56,388,070 Y175C possibly damaging Het
Gm5478 T A 15: 101,644,624 I338F probably damaging Het
Greb1 T A 12: 16,682,193 Y1589F probably damaging Het
Grk3 C T 5: 112,920,053 E537K probably damaging Het
H2-K1 G T 17: 33,999,500 D127E probably damaging Het
Hcrtr2 A G 9: 76,230,684 L383P probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ikbke A T 1: 131,270,184 probably null Het
Il1r2 A G 1: 40,105,455 K101E probably benign Het
Itga11 A T 9: 62,774,371 H1054L probably benign Het
Kif13a A T 13: 46,802,711 V539D probably damaging Het
Kifc1 G A 17: 33,886,647 T62I probably damaging Het
Klhl28 A G 12: 64,951,755 Y322H probably damaging Het
Klhl6 C A 16: 19,957,014 D265Y possibly damaging Het
Krt86 T A 15: 101,479,531 C479S unknown Het
Lama2 C T 10: 27,189,131 R1179H probably benign Het
Lce6a A T 3: 92,620,328 H57Q probably benign Het
Lcn11 T C 2: 25,779,293 V154A probably benign Het
Lnpep A T 17: 17,538,554 F843I probably damaging Het
Lrrc49 C T 9: 60,666,357 V281I probably benign Het
Lrrtm1 C A 6: 77,244,628 A356E probably damaging Het
Map3k1 A C 13: 111,763,510 H493Q probably benign Het
Mcm4 A T 16: 15,632,115 probably null Het
Mdn1 C T 4: 32,712,014 P1844L probably damaging Het
Mdn1 T A 4: 32,732,829 D3076E probably benign Het
Med6 A T 12: 81,589,024 L27H probably damaging Het
Mkl2 A G 16: 13,381,601 E106G probably damaging Het
Myo7a T A 7: 98,071,946 T1271S probably damaging Het
Myo9a T A 9: 59,921,793 M2376K probably benign Het
Nell2 G A 15: 95,229,214 T760I probably benign Het
Neurod6 C T 6: 55,679,587 A22T probably benign Het
Nlrp10 T C 7: 108,924,285 K663E probably benign Het
Npr3 T A 15: 11,845,282 K501N probably benign Het
Nr2f2 C A 7: 70,354,712 R264L probably damaging Het
Nup35 T A 2: 80,642,640 M19K probably benign Het
Oacyl A T 18: 65,747,891 Q592L possibly damaging Het
Olfr1061 T A 2: 86,413,170 N294I probably damaging Het
Olfr1243 A G 2: 89,528,107 V101A possibly damaging Het
Olfr1378 C A 11: 50,969,843 A275D possibly damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1484 T A 19: 13,586,170 Y289N probably damaging Het
Olfr17 T A 7: 107,097,726 I87K probably benign Het
Olfr312 T A 11: 58,831,972 S273T probably damaging Het
Olfr470 A G 7: 107,845,569 S55P probably damaging Het
Olfr56 C G 11: 49,134,722 H177D probably damaging Het
Olfr813 T G 10: 129,857,201 S228A possibly damaging Het
Olfr827 T C 10: 130,211,070 E20G probably benign Het
Patl2 T C 2: 122,126,669 Y128C probably benign Het
Pcdhac2 A G 18: 37,145,889 I641V probably benign Het
Polr2b T C 5: 77,313,159 probably benign Het
Pot1b A T 17: 55,665,765 I469N probably damaging Het
Prdm11 G T 2: 93,013,785 D33E possibly damaging Het
Prkdc A G 16: 15,772,057 S2595G probably damaging Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Prrc2b G T 2: 32,213,870 R1120L probably damaging Het
Prss38 T C 11: 59,375,543 S30G possibly damaging Het
Raph1 A T 1: 60,525,869 L153Q probably damaging Het
Reck A G 4: 43,940,719 T843A probably benign Het
Rgs7bp T C 13: 104,967,102 N164D probably benign Het
Rpusd4 C A 9: 35,267,993 A35D possibly damaging Het
Setd1b T C 5: 123,159,951 probably benign Het
Siglec15 G T 18: 78,046,137 D297E probably benign Het
Skint7 T A 4: 111,977,459 C13* probably null Het
Slc5a12 A G 2: 110,632,743 M395V probably benign Het
Sohlh2 C A 3: 55,207,683 S363Y probably damaging Het
Srgap3 A T 6: 112,723,119 V966E probably damaging Het
Stk4 C T 2: 164,098,542 P266L probably damaging Het
Stxbp5l G A 16: 37,142,432 H754Y probably benign Het
Synpo2l A T 14: 20,660,680 M624K probably damaging Het
Tas2r136 T C 6: 132,777,412 I251V probably benign Het
Tecpr1 C T 5: 144,212,590 V340M probably damaging Het
Tecta C T 9: 42,388,205 G196S probably damaging Het
Thsd7a T A 6: 12,331,542 probably null Het
Timeless T C 10: 128,246,334 V577A probably benign Het
Tln1 A T 4: 43,553,071 V340E probably damaging Het
Tmem132c T A 5: 127,563,553 Y929* probably null Het
Tmprss7 C T 16: 45,669,551 R436Q probably damaging Het
Tnik A C 3: 28,650,159 K989T probably damaging Het
Tnxb T A 17: 34,671,918 Y412N probably damaging Het
Trmt44 A G 5: 35,568,759 probably null Het
Trpm6 C A 19: 18,872,221 T1704N probably benign Het
Tsc2 A T 17: 24,621,712 V391E probably damaging Het
Ttc22 T C 4: 106,639,313 V520A possibly damaging Het
Ttc3 T A 16: 94,456,785 Y1650* probably null Het
Vmn2r24 A G 6: 123,786,934 T257A probably benign Het
Xab2 A C 8: 3,613,605 N408K probably benign Het
Zbtb42 A T 12: 112,680,627 Y412F probably benign Het
Zfp282 A G 6: 47,880,369 N179D probably damaging Het
Zfp62 C A 11: 49,215,400 T106K probably benign Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36559989 missense
R7208:Ankhd1 UTSW 18 36625028 missense probably benign
R7305:Ankhd1 UTSW 18 36632205 missense
R7615:Ankhd1 UTSW 18 36656773 missense
R7654:Ankhd1 UTSW 18 36594101 missense probably damaging 1.00
R7781:Ankhd1 UTSW 18 36625205 missense probably damaging 1.00
RF001:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF004:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF007:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF008:Ankhd1 UTSW 18 36560924 small insertion probably benign
RF009:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF013:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF017:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF018:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF026:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560913 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF039:Ankhd1 UTSW 18 36560918 small insertion probably benign
RF043:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF046:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF049:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF050:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF054:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF057:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF060:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF061:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF062:Ankhd1 UTSW 18 36560918 small insertion probably benign
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- aatgcaccactgTGGCAGCCTACT -3'
(R):5'- GCTGGGACTGAACTCATGGCCTTTT -3'

Sequencing Primer
(F):5'- tgTGGCAGCCTACTGCTTG -3'
(R):5'- ATGGCCTTTTTGCCACTGAATG -3'
Posted On2013-07-11