Mutagenetix > Incidental Mutation

Incidental Mutation 'R0607:Celsr2'

54232

Institutional Source

Beutler Lab

Gene Symbol

Celsr2

Ensembl Gene

ENSMUSG00000068740

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 2

Synonyms

mfmi1, EGFL2, flamingo

MMRRC Submission

038796-MU

Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0607 (G1)

Quality Score

211

Status

Not validated

Chromosome

Chromosomal Location

108390851-108415552 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 108403895 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000088046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090558]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000090558

SMART Domains

Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	35	53	N/A	INTRINSIC
CA	203	287	1.36e-26	SMART
CA	311	397	1.33e-29	SMART
CA	421	503	2.59e-27	SMART
CA	527	608	3.33e-30	SMART
CA	632	710	5.18e-18	SMART
CA	734	813	1.08e-29	SMART
CA	837	919	8.08e-29	SMART
low complexity region	920	932	N/A	INTRINSIC
CA	943	1021	4.3e-24	SMART
CA	1049	1125	1.87e-1	SMART
low complexity region	1188	1198	N/A	INTRINSIC
EGF	1231	1286	1.81e-3	SMART
EGF_CA	1288	1324	2.24e-8	SMART
EGF	1331	1366	6.65e-2	SMART
LamG	1387	1554	8.4e-30	SMART
EGF	1577	1610	8e-5	SMART
LamG	1636	1770	1.56e-24	SMART
EGF	1796	1829	2.35e-2	SMART
EGF	1831	1867	3.88e-3	SMART
TNFR	1908	1943	1.35e-1	SMART
EGF_Lam	1924	1969	9.54e-12	SMART
HormR	1972	2034	1.57e-20	SMART
Pfam:GAIN	2046	2289	3e-62	PFAM
GPS	2315	2368	1.86e-25	SMART
Pfam:7tm_2	2373	2605	1.1e-48	PFAM
low complexity region	2715	2733	N/A	INTRINSIC
low complexity region	2857	2873	N/A	INTRINSIC
low complexity region	2874	2881	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147251

SMART Domains

Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740

Domain	Start	End	E-Value	Type
Pfam:GAIN	35	278	5.1e-63	PFAM
GPS	304	357	1.86e-25	SMART
Pfam:7tm_2	362	594	2e-49	PFAM
low complexity region	704	722	N/A	INTRINSIC
low complexity region	846	862	N/A	INTRINSIC
low complexity region	863	870	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147565

SMART Domains

Protein: ENSMUSP00000122516
Gene: ENSMUSG00000068740

Domain	Start	End	E-Value	Type
EGF	13	46	8e-5	SMART
LamG	72	206	1.56e-24	SMART

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.6%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock

Total: 147 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	A	G	7: 12,554,698	E146G	probably benign	Het
4930435E12Rik	A	C	16: 38,828,364	S128A	probably benign	Het
Abca4	G	A	3: 122,156,432	G594S	probably damaging	Het
Acacb	T	C	5: 114,200,301	Y726H	probably damaging	Het
Adam20	T	A	8: 40,795,480	M209K	probably benign	Het
Adam29	A	G	8: 55,873,275	V48A	probably damaging	Het
Adss	A	G	1: 177,767,687	V429A	possibly damaging	Het
Aff1	T	C	5: 103,828,454	S481P	probably damaging	Het
Akr1c19	G	A	13: 4,238,460	A146T	probably benign	Het
Ankhd1	G	T	18: 36,640,280	V59F	probably damaging	Het
Ankmy1	T	G	1: 92,888,675	Y239S	probably damaging	Het
Ankrd24	G	T	10: 81,638,308	C19F	probably damaging	Het
Apaf1	T	C	10: 91,009,203	H1002R	probably damaging	Het
Apc2	T	C	10: 80,314,101	I1663T	probably benign	Het
Apcdd1	A	G	18: 62,951,896	N388S	possibly damaging	Het
Arap2	G	A	5: 62,606,131	P1557S	possibly damaging	Het
Armc2	T	A	10: 41,922,695	H706L	probably benign	Het
Arrb1	T	C	7: 99,588,196		probably null	Het
Atl3	T	C	19: 7,529,666		probably null	Het
B9d2	A	G	7: 25,683,332	T44A	probably damaging	Het
Btbd3	C	T	2: 138,283,816	R307W	possibly damaging	Het
C1galt1	T	C	6: 7,871,193	I343T	probably benign	Het
Cacna1a	A	G	8: 84,629,831	D1901G	probably damaging	Het
Ccdc42	C	T	11: 68,597,710	Q312*	probably null	Het
Cdh18	T	C	15: 23,410,790	Y454H	probably benign	Het
Celf5	G	A	10: 81,466,005	T317I	probably damaging	Het
Cenpf	A	T	1: 189,682,463		probably null	Het
Cep350	T	C	1: 155,872,048	D2042G	probably damaging	Het
Chd3	T	C	11: 69,344,358	D2054G	probably damaging	Het
Chgb	A	G	2: 132,793,335	H399R	probably benign	Het
Clp1	C	T	2: 84,725,591	A182T	possibly damaging	Het
Col15a1	A	G	4: 47,282,654	N777S	probably damaging	Het
Coq6	A	G	12: 84,368,638	D145G	possibly damaging	Het
Csf2rb2	T	C	15: 78,287,908	Y325C	probably benign	Het
Ctnna2	T	C	6: 76,902,430	T824A	probably benign	Het
Cyp4x1	T	A	4: 115,112,826	D368V	probably damaging	Het
D10Wsu102e	T	C	10: 83,362,097	S56P	probably benign	Het
D430041D05Rik	C	T	2: 104,233,445	R1354H	probably damaging	Het
D6Ertd527e	A	C	6: 87,111,905	D350A	unknown	Het
Ddx24	A	G	12: 103,419,067	Y426H	possibly damaging	Het
Dexi	G	T	16: 10,542,562	Y43*	probably null	Het
Dgka	A	G	10: 128,720,469		probably null	Het
Dhx38	A	T	8: 109,558,943	D419E	probably benign	Het
Dlg1	C	A	16: 31,665,580	Q9K	probably benign	Het
Dlg1	G	A	16: 31,838,174	V596I	possibly damaging	Het
Dnah11	A	C	12: 118,082,511	W1731G	probably damaging	Het
Dnhd1	T	A	7: 105,720,788	N4473K	probably benign	Het
Dync2h1	A	C	9: 7,051,480	S3152A	probably benign	Het
Egfl7	C	T	2: 26,589,440	T68I	probably damaging	Het
Eif2a	G	A	3: 58,555,652		probably null	Het
Emb	G	A	13: 117,232,750	V56I	possibly damaging	Het
Enpp4	A	T	17: 44,099,495	C397S	probably damaging	Het
Entpd3	A	G	9: 120,557,405	T151A	possibly damaging	Het
Ero1lb	A	G	13: 12,574,866	D50G	probably damaging	Het
Fam219a	A	G	4: 41,520,242	*169Q	probably null	Het
Fga	G	A	3: 83,028,562	G32E	probably damaging	Het
Fkbpl	T	C	17: 34,645,359	F34L	probably benign	Het
Fsd2	T	A	7: 81,545,017	D466V	probably damaging	Het
Gja1	A	G	10: 56,388,070	Y175C	possibly damaging	Het
Gm5478	T	A	15: 101,644,624	I338F	probably damaging	Het
Greb1	T	A	12: 16,682,193	Y1589F	probably damaging	Het
Grk3	C	T	5: 112,920,053	E537K	probably damaging	Het
H2-K1	G	T	17: 33,999,500	D127E	probably damaging	Het
Hcrtr2	A	G	9: 76,230,684	L383P	probably benign	Het
Hmcn1	C	T	1: 150,638,900	V3574M	probably benign	Het
Ikbke	A	T	1: 131,270,184		probably null	Het
Il1r2	A	G	1: 40,105,455	K101E	probably benign	Het
Itga11	A	T	9: 62,774,371	H1054L	probably benign	Het
Kif13a	A	T	13: 46,802,711	V539D	probably damaging	Het
Kifc1	G	A	17: 33,886,647	T62I	probably damaging	Het
Klhl28	A	G	12: 64,951,755	Y322H	probably damaging	Het
Klhl6	C	A	16: 19,957,014	D265Y	possibly damaging	Het
Krt86	T	A	15: 101,479,531	C479S	unknown	Het
Lama2	C	T	10: 27,189,131	R1179H	probably benign	Het
Lce6a	A	T	3: 92,620,328	H57Q	probably benign	Het
Lcn11	T	C	2: 25,779,293	V154A	probably benign	Het
Lnpep	A	T	17: 17,538,554	F843I	probably damaging	Het
Lrrc49	C	T	9: 60,666,357	V281I	probably benign	Het
Lrrtm1	C	A	6: 77,244,628	A356E	probably damaging	Het
Map3k1	A	C	13: 111,763,510	H493Q	probably benign	Het
Mcm4	A	T	16: 15,632,115		probably null	Het
Mdn1	C	T	4: 32,712,014	P1844L	probably damaging	Het
Mdn1	T	A	4: 32,732,829	D3076E	probably benign	Het
Med6	A	T	12: 81,589,024	L27H	probably damaging	Het
Mkl2	A	G	16: 13,381,601	E106G	probably damaging	Het
Myo7a	T	A	7: 98,071,946	T1271S	probably damaging	Het
Myo9a	T	A	9: 59,921,793	M2376K	probably benign	Het
Nell2	G	A	15: 95,229,214	T760I	probably benign	Het
Neurod6	C	T	6: 55,679,587	A22T	probably benign	Het
Nlrp10	T	C	7: 108,924,285	K663E	probably benign	Het
Npr3	T	A	15: 11,845,282	K501N	probably benign	Het
Nr2f2	C	A	7: 70,354,712	R264L	probably damaging	Het
Nup35	T	A	2: 80,642,640	M19K	probably benign	Het
Oacyl	A	T	18: 65,747,891	Q592L	possibly damaging	Het
Olfr1061	T	A	2: 86,413,170	N294I	probably damaging	Het
Olfr1243	A	G	2: 89,528,107	V101A	possibly damaging	Het
Olfr1378	C	A	11: 50,969,843	A275D	possibly damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr1484	T	A	19: 13,586,170	Y289N	probably damaging	Het
Olfr17	T	A	7: 107,097,726	I87K	probably benign	Het
Olfr312	T	A	11: 58,831,972	S273T	probably damaging	Het
Olfr470	A	G	7: 107,845,569	S55P	probably damaging	Het
Olfr56	C	G	11: 49,134,722	H177D	probably damaging	Het
Olfr813	T	G	10: 129,857,201	S228A	possibly damaging	Het
Olfr827	T	C	10: 130,211,070	E20G	probably benign	Het
Patl2	T	C	2: 122,126,669	Y128C	probably benign	Het
Pcdhac2	A	G	18: 37,145,889	I641V	probably benign	Het
Polr2b	T	C	5: 77,313,159		probably benign	Het
Pot1b	A	T	17: 55,665,765	I469N	probably damaging	Het
Prdm11	G	T	2: 93,013,785	D33E	possibly damaging	Het
Prkdc	A	G	16: 15,772,057	S2595G	probably damaging	Het
Prrc1	G	A	18: 57,374,550	V259I	possibly damaging	Het
Prrc2b	G	T	2: 32,213,870	R1120L	probably damaging	Het
Prss38	T	C	11: 59,375,543	S30G	possibly damaging	Het
Raph1	A	T	1: 60,525,869	L153Q	probably damaging	Het
Reck	A	G	4: 43,940,719	T843A	probably benign	Het
Rgs7bp	T	C	13: 104,967,102	N164D	probably benign	Het
Rpusd4	C	A	9: 35,267,993	A35D	possibly damaging	Het
Setd1b	T	C	5: 123,159,951		probably benign	Het
Siglec15	G	T	18: 78,046,137	D297E	probably benign	Het
Skint7	T	A	4: 111,977,459	C13*	probably null	Het
Slc5a12	A	G	2: 110,632,743	M395V	probably benign	Het
Sohlh2	C	A	3: 55,207,683	S363Y	probably damaging	Het
Srgap3	A	T	6: 112,723,119	V966E	probably damaging	Het
Stk4	C	T	2: 164,098,542	P266L	probably damaging	Het
Stxbp5l	G	A	16: 37,142,432	H754Y	probably benign	Het
Synpo2l	A	T	14: 20,660,680	M624K	probably damaging	Het
Tas2r136	T	C	6: 132,777,412	I251V	probably benign	Het
Tecpr1	C	T	5: 144,212,590	V340M	probably damaging	Het
Tecta	C	T	9: 42,388,205	G196S	probably damaging	Het
Thsd7a	T	A	6: 12,331,542		probably null	Het
Timeless	T	C	10: 128,246,334	V577A	probably benign	Het
Tln1	A	T	4: 43,553,071	V340E	probably damaging	Het
Tmem132c	T	A	5: 127,563,553	Y929*	probably null	Het
Tmprss7	C	T	16: 45,669,551	R436Q	probably damaging	Het
Tnik	A	C	3: 28,650,159	K989T	probably damaging	Het
Tnxb	T	A	17: 34,671,918	Y412N	probably damaging	Het
Trmt44	A	G	5: 35,568,759		probably null	Het
Trpm6	C	A	19: 18,872,221	T1704N	probably benign	Het
Tsc2	A	T	17: 24,621,712	V391E	probably damaging	Het
Ttc22	T	C	4: 106,639,313	V520A	possibly damaging	Het
Ttc3	T	A	16: 94,456,785	Y1650*	probably null	Het
Vmn2r24	A	G	6: 123,786,934	T257A	probably benign	Het
Xab2	A	C	8: 3,613,605	N408K	probably benign	Het
Zbtb42	A	T	12: 112,680,627	Y412F	probably benign	Het
Zfp282	A	G	6: 47,880,369	N179D	probably damaging	Het
Zfp62	C	A	11: 49,215,400	T106K	probably benign	Het

Other mutations in Celsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Celsr2	APN	3	108413879	missense	possibly damaging	0.49
IGL01020:Celsr2	APN	3	108403270	missense	probably damaging	0.99
IGL01420:Celsr2	APN	3	108393763	missense	probably benign	0.13
IGL01448:Celsr2	APN	3	108393239	missense	probably damaging	0.99
IGL01559:Celsr2	APN	3	108406867	missense	possibly damaging	0.75
IGL01674:Celsr2	APN	3	108414843	missense	probably damaging	1.00
IGL01863:Celsr2	APN	3	108394022	missense	probably benign	0.00
IGL02309:Celsr2	APN	3	108396011	missense	probably damaging	1.00
IGL02325:Celsr2	APN	3	108412871	missense	probably damaging	1.00
IGL02409:Celsr2	APN	3	108413955	missense	probably damaging	1.00
IGL02514:Celsr2	APN	3	108397510	missense	probably benign	0.01
IGL02812:Celsr2	APN	3	108414113	missense	probably benign	0.25
IGL02894:Celsr2	APN	3	108395210	missense	probably damaging	1.00
IGL03281:Celsr2	APN	3	108412940	missense	probably damaging	1.00
barrow	UTSW	3	108394965	missense	possibly damaging	0.92
goldeneye	UTSW	3	108394919	missense	probably damaging	1.00
1mM(1):Celsr2	UTSW	3	108400838	missense	probably benign	0.01
ANU74:Celsr2	UTSW	3	108412499	missense	probably damaging	1.00
IGL02799:Celsr2	UTSW	3	108414062	missense	probably damaging	1.00
R0011:Celsr2	UTSW	3	108413402	missense	probably benign	0.19
R0031:Celsr2	UTSW	3	108413063	missense	probably damaging	1.00
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0090:Celsr2	UTSW	3	108393327	splice site	probably benign
R0140:Celsr2	UTSW	3	108397933	missense	probably benign	0.00
R0524:Celsr2	UTSW	3	108401587	missense	probably damaging	1.00
R0662:Celsr2	UTSW	3	108398520	missense	probably damaging	0.99
R0690:Celsr2	UTSW	3	108414977	missense	probably damaging	1.00
R0691:Celsr2	UTSW	3	108412623	missense	probably damaging	1.00
R0710:Celsr2	UTSW	3	108412712	missense	probably benign	0.42
R0730:Celsr2	UTSW	3	108398606	missense	probably damaging	1.00
R0815:Celsr2	UTSW	3	108401301	missense	possibly damaging	0.56
R0848:Celsr2	UTSW	3	108414338	missense	probably benign
R0989:Celsr2	UTSW	3	108403272	missense	probably benign	0.00
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1474:Celsr2	UTSW	3	108393739	missense	possibly damaging	0.91
R1608:Celsr2	UTSW	3	108402483	missense	probably damaging	1.00
R1653:Celsr2	UTSW	3	108413520	missense	possibly damaging	0.52
R1659:Celsr2	UTSW	3	108414095	missense	probably benign
R1689:Celsr2	UTSW	3	108407304	missense	possibly damaging	0.63
R1848:Celsr2	UTSW	3	108401310	missense	probably benign	0.35
R1859:Celsr2	UTSW	3	108396630	missense	probably damaging	1.00
R1918:Celsr2	UTSW	3	108398650	missense	probably benign	0.05
R1974:Celsr2	UTSW	3	108414214	missense	probably damaging	1.00
R2042:Celsr2	UTSW	3	108402495	missense	probably damaging	0.98
R2167:Celsr2	UTSW	3	108413193	missense	probably damaging	0.96
R2333:Celsr2	UTSW	3	108398605	missense	probably benign	0.16
R2434:Celsr2	UTSW	3	108404479	missense	probably damaging	1.00
R2504:Celsr2	UTSW	3	108413591	missense	probably benign	0.11
R3420:Celsr2	UTSW	3	108414416	missense	probably benign	0.03
R3712:Celsr2	UTSW	3	108400839	missense	probably benign
R3723:Celsr2	UTSW	3	108397415	splice site	probably benign
R3809:Celsr2	UTSW	3	108403239	missense	possibly damaging	0.67
R4018:Celsr2	UTSW	3	108394965	missense	possibly damaging	0.92
R4126:Celsr2	UTSW	3	108402097	missense	possibly damaging	0.71
R4177:Celsr2	UTSW	3	108413978	missense	probably damaging	0.96
R4232:Celsr2	UTSW	3	108413772	missense	probably benign	0.02
R4293:Celsr2	UTSW	3	108393677	missense	probably benign	0.01
R4458:Celsr2	UTSW	3	108394997	missense	probably damaging	0.98
R4621:Celsr2	UTSW	3	108395216	missense	possibly damaging	0.86
R4645:Celsr2	UTSW	3	108395969	missense	probably damaging	1.00
R4700:Celsr2	UTSW	3	108397231	missense	probably benign	0.24
R4732:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4733:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4901:Celsr2	UTSW	3	108406987	missense	possibly damaging	0.81
R4932:Celsr2	UTSW	3	108402758	missense	probably damaging	1.00
R4989:Celsr2	UTSW	3	108412629	missense	possibly damaging	0.62
R5052:Celsr2	UTSW	3	108412358	missense	probably damaging	1.00
R5093:Celsr2	UTSW	3	108413373	missense	possibly damaging	0.66
R5114:Celsr2	UTSW	3	108393996	missense	probably benign	0.05
R5120:Celsr2	UTSW	3	108393120	missense	probably benign	0.02
R5135:Celsr2	UTSW	3	108398659	missense	probably damaging	1.00
R5247:Celsr2	UTSW	3	108397630	missense	probably benign	0.34
R5381:Celsr2	UTSW	3	108402757	missense	probably damaging	1.00
R5412:Celsr2	UTSW	3	108399995	missense	probably damaging	1.00
R5445:Celsr2	UTSW	3	108392658	missense	probably benign	0.01
R5528:Celsr2	UTSW	3	108413294	missense	probably damaging	1.00
R5598:Celsr2	UTSW	3	108402803	missense	possibly damaging	0.82
R5652:Celsr2	UTSW	3	108396735	missense	probably null	0.49
R5697:Celsr2	UTSW	3	108403921	nonsense	probably null
R5718:Celsr2	UTSW	3	108393358	missense	probably benign
R5869:Celsr2	UTSW	3	108413909	missense	probably damaging	1.00
R5876:Celsr2	UTSW	3	108413943	missense	probably damaging	0.96
R6021:Celsr2	UTSW	3	108401245	missense	probably benign
R6054:Celsr2	UTSW	3	108406963	missense	possibly damaging	0.95
R6244:Celsr2	UTSW	3	108393128	missense	probably damaging	0.96
R6313:Celsr2	UTSW	3	108401214	missense	probably damaging	0.99
R6322:Celsr2	UTSW	3	108412574	missense	probably damaging	1.00
R6555:Celsr2	UTSW	3	108394919	missense	probably damaging	1.00
R6682:Celsr2	UTSW	3	108400501	critical splice donor site	probably null
R7062:Celsr2	UTSW	3	108402510	missense	possibly damaging	0.95
R7110:Celsr2	UTSW	3	108397865	missense	probably damaging	1.00
R7139:Celsr2	UTSW	3	108415359	missense	unknown
R7326:Celsr2	UTSW	3	108394995	missense	possibly damaging	0.85
R7425:Celsr2	UTSW	3	108402457	missense	probably damaging	1.00
R7452:Celsr2	UTSW	3	108413090	missense	possibly damaging	0.95
R7461:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7502:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R7613:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7644:Celsr2	UTSW	3	108413490	missense	probably damaging	0.99
R7666:Celsr2	UTSW	3	108398588	missense	probably benign
R7687:Celsr2	UTSW	3	108397769	missense	probably benign	0.27
R7695:Celsr2	UTSW	3	108402753	missense	probably damaging	1.00
R8002:Celsr2	UTSW	3	108403969	missense	probably damaging	1.00
R8052:Celsr2	UTSW	3	108412655	missense	probably damaging	1.00
R8283:Celsr2	UTSW	3	108396455	missense	probably damaging	1.00
R8356:Celsr2	UTSW	3	108413531	missense	possibly damaging	0.90
R8381:Celsr2	UTSW	3	108395636	missense	probably damaging	1.00
R8427:Celsr2	UTSW	3	108392633	makesense	probably null
R8435:Celsr2	UTSW	3	108414399	missense	probably benign
R8438:Celsr2	UTSW	3	108393823	missense	probably damaging	1.00
R8458:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8460:Celsr2	UTSW	3	108396777	missense	possibly damaging	0.84
R8462:Celsr2	UTSW	3	108412851	nonsense	probably null
R8479:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8480:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8512:Celsr2	UTSW	3	108413838	missense	probably damaging	1.00
R8694:Celsr2	UTSW	3	108406860	missense	probably damaging	1.00
R8772:Celsr2	UTSW	3	108397073	missense	possibly damaging	0.84
R8843:Celsr2	UTSW	3	108396127	splice site	probably benign
R8888:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8895:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8917:Celsr2	UTSW	3	108396566	missense	probably benign	0.00
R9119:Celsr2	UTSW	3	108401972	missense	possibly damaging	0.90
R9169:Celsr2	UTSW	3	108402546	missense	probably benign	0.04
R9209:Celsr2	UTSW	3	108414033	missense	probably benign	0.02
R9342:Celsr2	UTSW	3	108413126	missense	probably damaging	1.00
R9416:Celsr2	UTSW	3	108414768	missense	probably damaging	0.96
R9493:Celsr2	UTSW	3	108393758	missense	probably damaging	1.00
R9564:Celsr2	UTSW	3	108414518	missense	probably damaging	1.00
R9598:Celsr2	UTSW	3	108415262	missense	possibly damaging	0.72
R9629:Celsr2	UTSW	3	108401599	missense	probably damaging	1.00
R9691:Celsr2	UTSW	3	108394235	missense	probably damaging	1.00
X0020:Celsr2	UTSW	3	108396110	missense	probably damaging	1.00
X0050:Celsr2	UTSW	3	108401272	missense	probably benign	0.09
Z1088:Celsr2	UTSW	3	108414117	missense	probably damaging	1.00
Z1176:Celsr2	UTSW	3	108393131	missense	probably benign	0.10
Z1176:Celsr2	UTSW	3	108412341	missense	probably benign	0.07
Z1177:Celsr2	UTSW	3	108412220	missense	probably damaging	1.00
Z1177:Celsr2	UTSW	3	108413571	missense	probably benign	0.32
Z1191:Celsr2	UTSW	3	108414549	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGGTGGTCGATTCCCCTAGAGAAAG -3'
(R):5'- GACTCCATAGCCTTAGCCAAAGCG -3'

Sequencing Primer
(F):5'- CGATTCCCCTAGAGAAAGGACAG -3'
(R):5'- CAAAGCGCCAGTTTTGCTATTG -3'

Posted On

2013-07-11