Incidental Mutation 'R6991:Kri1'
ID543849
Institutional Source Beutler Lab
Gene Symbol Kri1
Ensembl Gene ENSMUSG00000035047
Gene NameKRI1 homolog
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6991 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location21273457-21287969 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 21287754 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038671] [ENSMUST00000086374] [ENSMUST00000184326] [ENSMUST00000213407] [ENSMUST00000215619]
Predicted Effect
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047
AA Change: D38G

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086374
SMART Domains Protein: ENSMUSP00000083561
Gene: ENSMUSG00000096472

DomainStartEndE-ValueType
ANK 41 69 1.01e2 SMART
ANK 73 102 1.73e-4 SMART
ANK 106 134 8.89e1 SMART
Blast:ANK 138 166 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184326
SMART Domains Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
Pfam:Kri1 207 317 4.4e-27 PFAM
Pfam:Kri1_C 381 472 3.6e-36 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213407
Predicted Effect probably benign
Transcript: ENSMUST00000215619
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene overlaps with the gene for cysteine endopeptidase AUT-like 4 in a head-to-tail orientation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,580,446 V278D probably damaging Het
2410089E03Rik A G 15: 8,252,206 E2843G unknown Het
9930021J03Rik A G 19: 29,719,108 L995S possibly damaging Het
Akap12 G T 10: 4,357,122 E1311* probably null Het
Ankdd1a T A 9: 65,508,675 D186V probably benign Het
Birc6 A G 17: 74,562,095 E346G probably damaging Het
Ccr7 A C 11: 99,145,304 V264G probably damaging Het
Col7a1 T C 9: 108,983,919 probably null Het
Coq8a T C 1: 180,179,068 T132A probably benign Het
Cyp2b10 G A 7: 25,917,355 S407N probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Ddx42 G A 11: 106,239,144 V421I probably damaging Het
Dip2c T A 13: 9,551,860 L285* probably null Het
Dip2c C T 13: 9,634,832 S1232F probably damaging Het
Dner T A 1: 84,476,402 R402* probably null Het
Dpysl3 A T 18: 43,353,891 I317N probably damaging Het
Dusp23 T A 1: 172,631,657 Y146F probably benign Het
Eef1a2 C A 2: 181,148,628 V412L possibly damaging Het
Epha7 C T 4: 28,821,489 T218I probably damaging Het
Gigyf2 T A 1: 87,407,136 C284S probably damaging Het
Gm16427 T A 5: 93,484,374 N107I probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Hdhd5 A G 6: 120,510,169 V409A probably damaging Het
Kif9 T C 9: 110,494,622 Y236H probably damaging Het
Lig4 A T 8: 9,971,098 V894E probably damaging Het
Lrriq1 T C 10: 103,187,458 N982S probably damaging Het
Mapk8 T C 14: 33,410,884 I32V possibly damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mstn T C 1: 53,061,941 I59T probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Npw A C 17: 24,658,055 V124G probably benign Het
Nxph3 A G 11: 95,511,418 S57P probably damaging Het
Olfr1000 T C 2: 85,608,248 I221V possibly damaging Het
Olfr1145 G A 2: 87,810,443 D208N possibly damaging Het
Olfr1443 G T 19: 12,680,748 L213F probably benign Het
Olfr493 T A 7: 108,346,088 N298Y possibly damaging Het
Olfr677 T C 7: 105,056,564 I106T probably damaging Het
Opn4 A T 14: 34,593,907 L390M probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g2e G A 4: 138,880,675 C62Y probably damaging Het
Plcb4 G A 2: 135,910,194 V107M probably damaging Het
Prorsd1 A C 11: 29,514,486 probably benign Het
Prox2 A G 12: 85,087,391 L587P probably benign Het
Prr22 A G 17: 56,771,345 D166G possibly damaging Het
Ptprz1 G A 6: 23,002,687 R1592Q probably benign Het
Rarg C G 15: 102,241,915 R74P probably damaging Het
Rcan1 A G 16: 92,397,363 V54A probably benign Het
Rmdn2 A G 17: 79,621,310 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Serpina1a T C 12: 103,853,833 T385A probably benign Het
Slc44a3 T C 3: 121,532,165 Y12C probably benign Het
Smg1 C A 7: 118,167,868 probably benign Het
Spock3 A G 8: 63,355,381 *437W probably null Het
Sugct T A 13: 17,554,380 Q220H probably benign Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tnks C A 8: 34,834,493 R1274I probably damaging Het
Trp53bp1 C T 2: 121,208,040 R1439H probably damaging Het
Vmn1r16 G T 6: 57,322,884 S251* probably null Het
Vmn2r15 T A 5: 109,293,314 Q226L probably damaging Het
Vmn2r67 T G 7: 85,155,745 Y53S possibly damaging Het
Vmn2r99 A G 17: 19,378,110 N132S probably benign Het
Wdr73 T G 7: 80,891,856 T313P probably benign Het
Zfp65 C T 13: 67,708,521 R213Q probably damaging Het
Other mutations in Kri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Kri1 APN 9 21280427 missense probably damaging 1.00
IGL02272:Kri1 APN 9 21276168 missense probably damaging 1.00
IGL03229:Kri1 APN 9 21282070 missense probably damaging 1.00
FR4548:Kri1 UTSW 9 21281050 small deletion probably benign
R0040:Kri1 UTSW 9 21281105 missense probably damaging 1.00
R0054:Kri1 UTSW 9 21275365 missense probably damaging 1.00
R0054:Kri1 UTSW 9 21275365 missense probably damaging 1.00
R0284:Kri1 UTSW 9 21276552 splice site probably benign
R0665:Kri1 UTSW 9 21281640 intron probably benign
R1632:Kri1 UTSW 9 21282211 missense possibly damaging 0.89
R1640:Kri1 UTSW 9 21280457 missense possibly damaging 0.61
R1847:Kri1 UTSW 9 21280492 splice site probably benign
R3154:Kri1 UTSW 9 21281894 missense possibly damaging 0.51
R4222:Kri1 UTSW 9 21281063 missense probably benign 0.00
R4572:Kri1 UTSW 9 21280384 missense probably damaging 1.00
R4905:Kri1 UTSW 9 21287702 missense probably benign 0.19
R5236:Kri1 UTSW 9 21275941 missense probably damaging 1.00
R5539:Kri1 UTSW 9 21279372 nonsense probably null
R5696:Kri1 UTSW 9 21280237 missense probably damaging 1.00
R5701:Kri1 UTSW 9 21281129 missense possibly damaging 0.89
R6031:Kri1 UTSW 9 21275269 missense probably benign 0.03
R6031:Kri1 UTSW 9 21275269 missense probably benign 0.03
R6994:Kri1 UTSW 9 21287787 unclassified probably benign
R7095:Kri1 UTSW 9 21279432 missense
R7339:Kri1 UTSW 9 21286587 missense
R7652:Kri1 UTSW 9 21281056 small deletion probably benign
R7787:Kri1 UTSW 9 21281084 missense
R7908:Kri1 UTSW 9 21281056 small deletion probably benign
R8781:Kri1 UTSW 9 21280452 missense
RF027:Kri1 UTSW 9 21281068 frame shift probably null
RF028:Kri1 UTSW 9 21281071 frame shift probably null
RF058:Kri1 UTSW 9 21281066 frame shift probably null
Z1088:Kri1 UTSW 9 21274122 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTGGAGTCTCTTCCAGAAAG -3'
(R):5'- GTGCCTAAAGGTGAACGCAG -3'

Sequencing Primer
(F):5'- AAGGAGGATGTATTTGGCGATCCC -3'
(R):5'- TTCAGCGACGTGAGTGA -3'
Posted On2019-05-13