Incidental Mutation 'R6991:Prr22'
ID 543876
Institutional Source Beutler Lab
Gene Symbol Prr22
Ensembl Gene ENSMUSG00000090273
Gene Name proline rich 22
Synonyms LOC224908, Gm546
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R6991 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 56770250-56772208 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 56771345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000127457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002444] [ENSMUST00000007747] [ENSMUST00000086801] [ENSMUST00000168666]
AlphaFold F6TNE3
Predicted Effect probably benign
Transcript: ENSMUST00000002444
SMART Domains Protein: ENSMUSP00000002444
Gene: ENSMUSG00000024206

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 4 149 1.9e-50 PFAM
Pfam:RFX_DNA_binding 192 269 4.3e-36 PFAM
Blast:HisKA 479 542 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000007747
SMART Domains Protein: ENSMUSP00000007747
Gene: ENSMUSG00000007603

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Blast:ZnF_C3H1 109 136 2e-6 BLAST
Blast:ZnF_C3H1 146 172 6e-9 BLAST
Pfam:Dus 295 566 2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086801
SMART Domains Protein: ENSMUSP00000084010
Gene: ENSMUSG00000024206

DomainStartEndE-ValueType
Pfam:RFX1_trans_act 1 151 6.8e-56 PFAM
Pfam:RFX_DNA_binding 161 246 6e-41 PFAM
Blast:HisKA 454 517 1e-31 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000168666
AA Change: D166G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127457
Gene: ENSMUSG00000090273
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
Pfam:PRR22 58 422 2.3e-169 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,580,446 V278D probably damaging Het
2410089E03Rik A G 15: 8,252,206 E2843G unknown Het
9930021J03Rik A G 19: 29,719,108 L995S possibly damaging Het
Akap12 G T 10: 4,357,122 E1311* probably null Het
Ankdd1a T A 9: 65,508,675 D186V probably benign Het
Birc6 A G 17: 74,562,095 E346G probably damaging Het
Ccr7 A C 11: 99,145,304 V264G probably damaging Het
Col7a1 T C 9: 108,983,919 probably null Het
Coq8a T C 1: 180,179,068 T132A probably benign Het
Cyp2b10 G A 7: 25,917,355 S407N probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Ddx42 G A 11: 106,239,144 V421I probably damaging Het
Dip2c T A 13: 9,551,860 L285* probably null Het
Dip2c C T 13: 9,634,832 S1232F probably damaging Het
Dner T A 1: 84,476,402 R402* probably null Het
Dpysl3 A T 18: 43,353,891 I317N probably damaging Het
Dusp23 T A 1: 172,631,657 Y146F probably benign Het
Eef1a2 C A 2: 181,148,628 V412L possibly damaging Het
Epha7 C T 4: 28,821,489 T218I probably damaging Het
Gigyf2 T A 1: 87,407,136 C284S probably damaging Het
Gm16427 T A 5: 93,484,374 N107I probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Hdhd5 A G 6: 120,510,169 V409A probably damaging Het
Kif9 T C 9: 110,494,622 Y236H probably damaging Het
Kri1 T C 9: 21,287,754 probably benign Het
Lig4 A T 8: 9,971,098 V894E probably damaging Het
Lrriq1 T C 10: 103,187,458 N982S probably damaging Het
Mapk8 T C 14: 33,410,884 I32V possibly damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mstn T C 1: 53,061,941 I59T probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Npw A C 17: 24,658,055 V124G probably benign Het
Nxph3 A G 11: 95,511,418 S57P probably damaging Het
Olfr1000 T C 2: 85,608,248 I221V possibly damaging Het
Olfr1145 G A 2: 87,810,443 D208N possibly damaging Het
Olfr1443 G T 19: 12,680,748 L213F probably benign Het
Olfr493 T A 7: 108,346,088 N298Y possibly damaging Het
Olfr677 T C 7: 105,056,564 I106T probably damaging Het
Opn4 A T 14: 34,593,907 L390M probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g2e G A 4: 138,880,675 C62Y probably damaging Het
Plcb4 G A 2: 135,910,194 V107M probably damaging Het
Prorsd1 A C 11: 29,514,486 probably benign Het
Prox2 A G 12: 85,087,391 L587P probably benign Het
Ptprz1 G A 6: 23,002,687 R1592Q probably benign Het
Rarg C G 15: 102,241,915 R74P probably damaging Het
Rcan1 A G 16: 92,397,363 V54A probably benign Het
Rmdn2 A G 17: 79,621,310 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Serpina1a T C 12: 103,853,833 T385A probably benign Het
Slc44a3 T C 3: 121,532,165 Y12C probably benign Het
Smg1 C A 7: 118,167,868 probably benign Het
Spock3 A G 8: 63,355,381 *437W probably null Het
Sugct T A 13: 17,554,380 Q220H probably benign Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tnks C A 8: 34,834,493 R1274I probably damaging Het
Trp53bp1 C T 2: 121,208,040 R1439H probably damaging Het
Vmn1r16 G T 6: 57,322,884 S251* probably null Het
Vmn2r15 T A 5: 109,293,314 Q226L probably damaging Het
Vmn2r67 T G 7: 85,155,745 Y53S possibly damaging Het
Vmn2r99 A G 17: 19,378,110 N132S probably benign Het
Wdr73 T G 7: 80,891,856 T313P probably benign Het
Zfp65 C T 13: 67,708,521 R213Q probably damaging Het
Other mutations in Prr22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0462:Prr22 UTSW 17 56770551 unclassified probably benign
R0787:Prr22 UTSW 17 56771072 missense possibly damaging 0.71
R2290:Prr22 UTSW 17 56771884 missense probably benign
R4749:Prr22 UTSW 17 56771274 missense possibly damaging 0.51
R5099:Prr22 UTSW 17 56771467 missense probably benign 0.32
R6268:Prr22 UTSW 17 56771587 missense probably damaging 0.98
R6339:Prr22 UTSW 17 56771490 missense probably benign 0.02
R6542:Prr22 UTSW 17 56770527 splice site probably null
R6951:Prr22 UTSW 17 56772028 nonsense probably null
R7721:Prr22 UTSW 17 56771819 missense possibly damaging 0.92
R8352:Prr22 UTSW 17 56771311 missense probably damaging 1.00
R8452:Prr22 UTSW 17 56771311 missense probably damaging 1.00
R9479:Prr22 UTSW 17 56771335 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACAAAGTGGCAGTGGCTGG -3'
(R):5'- CATCTTCGAGAAGGACCTTGTC -3'

Sequencing Primer
(F):5'- TACTTGCTGGAGGCCCCATC -3'
(R):5'- AATCGCAGACCTGGCCTG -3'
Posted On 2019-05-13