Incidental Mutation 'R4416:Bnc1'
ID326840
Institutional Source Beutler Lab
Gene Symbol Bnc1
Ensembl Gene ENSMUSG00000025105
Gene Namebasonuclin 1
Synonyms
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4416 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location81966672-81992292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81968960 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 786 (H786N)
Ref Sequence ENSEMBL: ENSMUSP00000026096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026096]
Predicted Effect probably benign
Transcript: ENSMUST00000026096
AA Change: H786N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026096
Gene: ENSMUSG00000025105
AA Change: H786N

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
ZnF_C2H2 354 377 1.43e-1 SMART
ZnF_C2H2 382 411 6.75e0 SMART
low complexity region 505 514 N/A INTRINSIC
low complexity region 541 554 N/A INTRINSIC
low complexity region 570 583 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
ZnF_C2H2 716 739 1.47e-3 SMART
ZnF_C2H2 744 771 5.62e0 SMART
low complexity region 855 876 N/A INTRINSIC
ZnF_C2H2 924 947 3.11e-2 SMART
ZnF_C2H2 952 979 8.09e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158486
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein present in the basal cell layer of the epidermis and in hair follicles. It is also found in abundance in the germ cells of testis and ovary. This protein is thought to play a regulatory role in keratinocyte proliferation and it may also be a regulator for rRNA transcription. Alternative splicing of this gene results in multiple transcript variants, and multiple polyadenylation sites are indicated.[provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit thinning and delayed wound healing of the corneal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Bnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Bnc1 APN 7 81973707 nonsense probably null
IGL01293:Bnc1 APN 7 81974489 missense probably damaging 0.99
IGL02064:Bnc1 APN 7 81973503 missense probably benign 0.00
IGL02529:Bnc1 APN 7 81977368 missense probably damaging 0.99
IGL03087:Bnc1 APN 7 81974642 missense possibly damaging 0.86
R0088:Bnc1 UTSW 7 81978498 missense possibly damaging 0.52
R0312:Bnc1 UTSW 7 81977324 missense possibly damaging 0.95
R0631:Bnc1 UTSW 7 81974366 missense probably damaging 0.99
R0924:Bnc1 UTSW 7 81978408 splice site probably benign
R0928:Bnc1 UTSW 7 81973502 missense probably benign
R1967:Bnc1 UTSW 7 81973636 missense probably benign 0.03
R2243:Bnc1 UTSW 7 81974073 missense possibly damaging 0.59
R2404:Bnc1 UTSW 7 81968715 missense probably benign 0.08
R4079:Bnc1 UTSW 7 81973760 missense probably damaging 0.99
R5038:Bnc1 UTSW 7 81968714 missense probably damaging 1.00
R5055:Bnc1 UTSW 7 81974415 missense probably damaging 0.99
R7083:Bnc1 UTSW 7 81973310 missense probably damaging 1.00
R7117:Bnc1 UTSW 7 81973361 missense possibly damaging 0.92
R7151:Bnc1 UTSW 7 81973307 missense possibly damaging 0.71
R7386:Bnc1 UTSW 7 81974492 missense possibly damaging 0.81
R7950:Bnc1 UTSW 7 81973502 missense probably benign
Z1176:Bnc1 UTSW 7 81974542 missense probably damaging 0.97
Z1177:Bnc1 UTSW 7 81968470 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAATCCAGGATGGTGCCCTC -3'
(R):5'- TTAACCCTGGCTGTGACTCC -3'

Sequencing Primer
(F):5'- AGGATGGTGCCCTCGCTAG -3'
(R):5'- TGTGACTCCCGCCACAC -3'
Posted On2015-07-07