Mutagenetix > Incidental Mutations

Incidental Mutation 'R4079:Bnc1'

316750

Institutional Source

Beutler Lab

Gene Symbol

Bnc1

Ensembl Gene

ENSMUSG00000025105

Gene Name

basonuclin 1

Synonyms

MMRRC Submission

040976-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81966672-81992292 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81973760 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 573 (E573G)

Ref Sequence

ENSEMBL: ENSMUSP00000026096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026096]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026096
AA Change: E573G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000026096
Gene: ENSMUSG00000025105
AA Change: E573G

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
low complexity region	313	327	N/A	INTRINSIC
ZnF_C2H2	354	377	1.43e-1	SMART
ZnF_C2H2	382	411	6.75e0	SMART
low complexity region	505	514	N/A	INTRINSIC
low complexity region	541	554	N/A	INTRINSIC
low complexity region	570	583	N/A	INTRINSIC
low complexity region	619	633	N/A	INTRINSIC
ZnF_C2H2	716	739	1.47e-3	SMART
ZnF_C2H2	744	771	5.62e0	SMART
low complexity region	855	876	N/A	INTRINSIC
ZnF_C2H2	924	947	3.11e-2	SMART
ZnF_C2H2	952	979	8.09e-1	SMART

Meta Mutation Damage Score

0.0821

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein present in the basal cell layer of the epidermis and in hair follicles. It is also found in abundance in the germ cells of testis and ovary. This protein is thought to play a regulatory role in keratinocyte proliferation and it may also be a regulator for rRNA transcription. Alternative splicing of this gene results in multiple transcript variants, and multiple polyadenylation sites are indicated.[provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit thinning and delayed wound healing of the corneal epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago3	C	G	4: 126,353,680		probably null	Het
Ankfy1	C	A	11: 72,690,009		probably benign	Het
Ap4b1	T	A	3: 103,813,378	N121K	probably damaging	Het
Arhgef12	T	C	9: 42,975,292	M1131V	probably damaging	Het
Arl5c	A	T	11: 97,993,501	I88N	probably damaging	Het
Armc9	A	T	1: 86,213,129		probably benign	Het
Btaf1	A	G	19: 36,986,479	T817A	probably benign	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cadm3	A	G	1: 173,341,669	V293A	probably benign	Het
Cadps	C	T	14: 12,457,702	A1060T	probably benign	Het
Cbfa2t3	A	G	8: 122,647,695		probably null	Het
Ccdc18	C	T	5: 108,158,528	Q270*	probably null	Het
Cdc45	A	T	16: 18,811,360	V19D	probably damaging	Het
Cfap57	C	A	4: 118,598,997	S500I	probably benign	Het
Cnga3	A	T	1: 37,241,865	Q47L	possibly damaging	Het
Corin	T	C	5: 72,503,883	D89G	probably benign	Het
Cox16	A	T	12: 81,474,335		probably benign	Het
Cyp2a4	A	G	7: 26,307,366	N50S	probably benign	Het
Diaph1	T	A	18: 37,853,583	E1116D	possibly damaging	Het
Dlg5	T	C	14: 24,148,260	D1535G	possibly damaging	Het
Enpp1	A	G	10: 24,669,007		probably null	Het
F13b	T	A	1: 139,501,770	F9I	unknown	Het
Fcer1a	C	T	1: 173,225,353	C36Y	probably damaging	Het
Fcho2	A	G	13: 98,755,612	V318A	probably damaging	Het
Fzd9	A	G	5: 135,249,636	V465A	probably benign	Het
Gm10354	A	T	5: 14,977,649	L71Q	probably damaging	Het
Hbs1l	T	C	10: 21,352,602	V493A	probably damaging	Het
Hgs	T	A	11: 120,483,048	S723T	probably benign	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Kpna7	A	G	5: 145,005,927	I83T	possibly damaging	Het
Llgl1	C	A	11: 60,710,284		probably null	Het
Lrig3	A	C	10: 126,009,787	E695A	probably damaging	Het
Lrpap1	A	G	5: 35,096,037	I261T	possibly damaging	Het
Mfn1	T	G	3: 32,542,849	L152W	probably damaging	Het
Mog	A	G	17: 37,012,410	F212S	probably damaging	Het
Mpeg1	A	G	19: 12,462,270	N364S	probably damaging	Het
Mtmr3	C	T	11: 4,491,057	R531Q	probably damaging	Het
Mx2	A	G	16: 97,556,036	N443S	probably damaging	Het
Nfatc3	T	C	8: 106,079,491	Y323H	probably damaging	Het
Nup188	G	A	2: 30,309,878	D305N	probably damaging	Het
Obscn	A	G	11: 59,038,363	V6145A	probably benign	Het
Olfr1037	A	G	2: 86,085,312	V155A	possibly damaging	Het
Olfr686	A	T	7: 105,204,021	H107Q	probably damaging	Het
Patl1	C	T	19: 11,931,630	A467V	probably damaging	Het
Pdss2	A	T	10: 43,402,522	M342L	probably benign	Het
Phax	A	G	18: 56,575,979	N183S	possibly damaging	Het
Pnck	A	T	X: 73,658,155	V93E	probably damaging	Het
Prol1	A	G	5: 88,328,216	N155S	unknown	Het
Ptprk	G	A	10: 28,263,512	V78I	probably benign	Het
Ptpru	A	T	4: 131,798,710		probably null	Het
Ptprv	A	G	1: 135,110,430		noncoding transcript	Het
Ranbp3l	A	G	15: 9,060,757	N233S	probably damaging	Het
Rapgefl1	A	G	11: 98,849,977	T552A	probably benign	Het
Rasgrp1	A	G	2: 117,285,029	S693P	probably benign	Het
Scyl2	A	T	10: 89,640,596	M889K	probably benign	Het
Serpina3a	C	T	12: 104,119,675	Q320*	probably null	Het
Slc12a1	A	T	2: 125,200,623	N733I	possibly damaging	Het
Snap47	C	T	11: 59,428,551	V254I	probably benign	Het
St6galnac2	A	T	11: 116,681,898	L244Q	possibly damaging	Het
Syce1	C	A	7: 140,779,896	L83F	probably damaging	Het
Tjp2	A	T	19: 24,108,818	V780E	possibly damaging	Het
Tns1	G	A	1: 73,995,308	R192C	probably damaging	Het
Trav6-3	T	C	14: 53,430,080	L3P	possibly damaging	Het
Ung	G	T	5: 114,130,623		probably null	Het
Usp32	T	A	11: 85,039,229	Y574F	probably damaging	Het

Other mutations in Bnc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Bnc1	APN	7	81973707	nonsense	probably null
IGL01293:Bnc1	APN	7	81974489	missense	probably damaging	0.99
IGL02064:Bnc1	APN	7	81973503	missense	probably benign	0.00
IGL02529:Bnc1	APN	7	81977368	missense	probably damaging	0.99
IGL03087:Bnc1	APN	7	81974642	missense	possibly damaging	0.86
R0088:Bnc1	UTSW	7	81978498	missense	possibly damaging	0.52
R0312:Bnc1	UTSW	7	81977324	missense	possibly damaging	0.95
R0631:Bnc1	UTSW	7	81974366	missense	probably damaging	0.99
R0924:Bnc1	UTSW	7	81978408	splice site	probably benign
R0928:Bnc1	UTSW	7	81973502	missense	probably benign
R1967:Bnc1	UTSW	7	81973636	missense	probably benign	0.03
R2243:Bnc1	UTSW	7	81974073	missense	possibly damaging	0.59
R2404:Bnc1	UTSW	7	81968715	missense	probably benign	0.08
R4416:Bnc1	UTSW	7	81968960	missense	probably benign
R5038:Bnc1	UTSW	7	81968714	missense	probably damaging	1.00
R5055:Bnc1	UTSW	7	81974415	missense	probably damaging	0.99
R7083:Bnc1	UTSW	7	81973310	missense	probably damaging	1.00
R7117:Bnc1	UTSW	7	81973361	missense	possibly damaging	0.92
R7151:Bnc1	UTSW	7	81973307	missense	possibly damaging	0.71
R7386:Bnc1	UTSW	7	81974492	missense	possibly damaging	0.81
Z1176:Bnc1	UTSW	7	81974542	missense	not run
Z1177:Bnc1	UTSW	7	81968470	missense	not run

Predicted Primers

PCR Primer
(F):5'- TACCAGGCCAGCTGTGAAATG -3'
(R):5'- ACAGCTGGTTTCCACAGAC -3'

Sequencing Primer
(F):5'- AGCTGTGAAATGGCGCTC -3'
(R):5'- AGACATGCCATTCGATGCTC -3'

Posted On

2015-05-15