Incidental Mutation 'R7153:Stab1'
ID 554274
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Name stabilin 1
Synonyms MS-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7153 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 31139013-31168641 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 31160584 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 432 (E432A)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036618
AA Change: E432A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: E432A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,992,943 T741A possibly damaging Het
Aox4 T C 1: 58,250,219 M767T probably damaging Het
Arhgap39 C A 15: 76,765,491 S27I probably benign Het
AU018091 T A 7: 3,159,513 M296L probably benign Het
Axin1 A G 17: 26,187,968 T512A probably benign Het
B4galnt3 A T 6: 120,214,968 D602E probably benign Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bsnd A T 4: 106,492,033 D3E probably benign Het
Btbd18 C T 2: 84,666,428 R137* probably null Het
C2cd5 A G 6: 143,019,409 S871P probably benign Het
Cobl G T 11: 12,254,128 P858Q probably damaging Het
Col6a1 C T 10: 76,710,341 probably null Het
Crb2 A T 2: 37,787,408 H304L probably benign Het
Crybg1 T A 10: 43,964,666 Y1812F possibly damaging Het
Ddx60 A T 8: 61,988,108 K1070N possibly damaging Het
Defb22 T C 2: 152,485,920 K115R unknown Het
Dhx8 C T 11: 101,740,175 probably null Het
Dnah5 T A 15: 28,365,522 probably null Het
Dnah7b T A 1: 46,126,804 F543Y probably benign Het
Ehhadh A G 16: 21,766,321 F270S probably damaging Het
Esyt2 A G 12: 116,346,508 M397V probably benign Het
Fanca A T 8: 123,316,425 L74H probably damaging Het
Fbxl17 C A 17: 63,060,351 V676F probably benign Het
Fndc1 A G 17: 7,801,645 V102A probably damaging Het
Gpalpp1 T C 14: 76,095,011 Y273C probably damaging Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Grik2 T C 10: 49,535,367 H225R probably benign Het
Helz2 A T 2: 181,231,285 S2411T probably benign Het
Hnmt C T 2: 24,014,341 A103T probably damaging Het
Ighv15-2 G T 12: 114,564,590 Y114* probably null Het
Irak2 A G 6: 113,678,709 H357R probably benign Het
Kcp T C 6: 29,499,015 E320G probably damaging Het
Kpna4 A G 3: 69,089,798 L352S probably damaging Het
Krt36 G A 11: 100,105,146 Q151* probably null Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lca5l T A 16: 96,173,809 N305I probably damaging Het
Lefty1 T A 1: 180,937,767 L300Q probably benign Het
Mertk A G 2: 128,736,649 Y185C probably damaging Het
Mmp14 T C 14: 54,436,251 I124T possibly damaging Het
Nlrc4 T C 17: 74,447,103 E95G possibly damaging Het
Npc1 A G 18: 12,213,291 F283L possibly damaging Het
Olfr1180 A C 2: 88,412,118 L180W probably damaging Het
Olfr1282 A T 2: 111,335,901 M59K probably damaging Het
Pcdha11 T C 18: 37,011,225 V123A probably damaging Het
Pcdhga2 T C 18: 37,669,208 V35A probably damaging Het
Pgd G T 4: 149,161,678 T94K probably benign Het
Pik3c2a T C 7: 116,342,252 N1593S probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb3 A G 19: 6,958,084 probably null Het
Prkd3 C T 17: 78,966,355 D491N probably benign Het
Ptprf T C 4: 118,231,543 T688A probably damaging Het
Pycr2 T A 1: 180,906,682 L210M probably damaging Het
Rpl36 T C 17: 56,614,137 I81T probably benign Het
Rraga C T 4: 86,576,016 A33V probably damaging Het
Slc29a1 G A 17: 45,585,762 A429V probably damaging Het
Synj1 C T 16: 90,948,090 G1189R probably benign Het
Synpo2 A G 3: 123,112,404 *1088Q probably null Het
Tbc1d21 T C 9: 58,363,093 D133G probably damaging Het
Tenm2 A G 11: 36,024,182 V2176A probably damaging Het
Tff1 A G 17: 31,162,798 I35T probably benign Het
Thnsl1 T C 2: 21,212,953 V506A possibly damaging Het
Timm10b A G 7: 105,640,880 Q50R unknown Het
Tjp2 A T 19: 24,101,981 N843K probably benign Het
Tle1 A T 4: 72,139,061 F101I probably benign Het
Tmem225 T C 9: 40,148,368 F15L probably benign Het
Trav12-3 T C 14: 53,622,161 L88P probably benign Het
Ttc7b A T 12: 100,355,034 W613R probably damaging Het
Ttn T A 2: 76,778,504 M17723L probably benign Het
Ttn T C 2: 76,945,316 D1840G unknown Het
Tubgcp2 T C 7: 140,001,036 H668R probably benign Het
Ush2a C A 1: 188,728,484 N2647K possibly damaging Het
Vmn1r14 C T 6: 57,233,866 S143F probably benign Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Ywhab T C 2: 164,014,060 F119L probably damaging Het
Zmym2 T A 14: 56,950,202 D1108E probably benign Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31161357 missense probably benign 0.01
IGL00323:Stab1 APN 14 31139306 missense probably benign 0.04
IGL00515:Stab1 APN 14 31159729 missense probably benign 0.20
IGL00844:Stab1 APN 14 31147066 missense probably damaging 1.00
IGL01374:Stab1 APN 14 31147075 missense probably damaging 1.00
IGL01384:Stab1 APN 14 31150408 missense probably benign
IGL01431:Stab1 APN 14 31148995 missense probably benign 0.06
IGL01787:Stab1 APN 14 31139808 missense probably damaging 1.00
IGL02128:Stab1 APN 14 31150441 missense probably damaging 1.00
IGL02138:Stab1 APN 14 31143513 critical splice donor site probably null
IGL02256:Stab1 APN 14 31141592 missense probably damaging 1.00
IGL02340:Stab1 APN 14 31140410 missense probably damaging 0.96
IGL02507:Stab1 APN 14 31139210 unclassified probably benign
IGL02695:Stab1 APN 14 31159271 missense probably damaging 1.00
IGL02755:Stab1 APN 14 31139638 missense probably benign 0.01
IGL02870:Stab1 APN 14 31139397 missense probably benign 0.00
IGL02884:Stab1 APN 14 31150143 splice site probably null
IGL03035:Stab1 APN 14 31147769 missense probably benign 0.00
IGL03267:Stab1 APN 14 31142729 missense probably damaging 1.00
IGL03286:Stab1 APN 14 31159326 splice site probably benign
IGL03366:Stab1 APN 14 31150263 missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31154407 missense probably benign 0.42
R0906_Stab1_335 UTSW 14 31145249 missense probably benign 0.19
R5086_Stab1_467 UTSW 14 31159304 missense probably damaging 1.00
IGL02835:Stab1 UTSW 14 31146024 critical splice donor site probably null
K7371:Stab1 UTSW 14 31150249 missense probably damaging 1.00
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0363:Stab1 UTSW 14 31159008 splice site probably benign
R0387:Stab1 UTSW 14 31148101 missense probably benign 0.00
R0391:Stab1 UTSW 14 31143418 missense probably benign 0.21
R0513:Stab1 UTSW 14 31148945 missense probably benign 0.08
R0546:Stab1 UTSW 14 31139550 missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31152600 missense probably benign 0.16
R0906:Stab1 UTSW 14 31145249 missense probably benign 0.19
R0963:Stab1 UTSW 14 31147274 missense probably damaging 0.97
R1219:Stab1 UTSW 14 31140621 splice site probably null
R1234:Stab1 UTSW 14 31150236 missense probably damaging 1.00
R1260:Stab1 UTSW 14 31151889 missense probably damaging 1.00
R1400:Stab1 UTSW 14 31139830 missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1440:Stab1 UTSW 14 31151690 nonsense probably null
R1472:Stab1 UTSW 14 31141586 missense probably benign 0.01
R1474:Stab1 UTSW 14 31149861 missense probably benign 0.45
R1475:Stab1 UTSW 14 31163828 missense probably benign
R1509:Stab1 UTSW 14 31151584 splice site probably benign
R1551:Stab1 UTSW 14 31160499 missense probably benign 0.00
R1572:Stab1 UTSW 14 31150823 missense probably damaging 1.00
R1633:Stab1 UTSW 14 31150380 splice site probably null
R1719:Stab1 UTSW 14 31146028 nonsense probably null
R1733:Stab1 UTSW 14 31145303 missense probably damaging 1.00
R1763:Stab1 UTSW 14 31168416 missense probably benign 0.04
R1808:Stab1 UTSW 14 31141144 missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31157465 missense probably benign 0.03
R1853:Stab1 UTSW 14 31140463 missense probably damaging 1.00
R1891:Stab1 UTSW 14 31141330 missense probably benign 0.07
R1984:Stab1 UTSW 14 31150648 missense probably benign 0.20
R1998:Stab1 UTSW 14 31162153 nonsense probably null
R2165:Stab1 UTSW 14 31168435 missense probably benign 0.20
R2191:Stab1 UTSW 14 31142800 missense probably benign 0.03
R2191:Stab1 UTSW 14 31159270 missense probably damaging 1.00
R2233:Stab1 UTSW 14 31161880 missense probably benign 0.08
R2303:Stab1 UTSW 14 31146070 missense probably damaging 1.00
R2496:Stab1 UTSW 14 31161463 missense probably damaging 1.00
R2504:Stab1 UTSW 14 31163040 critical splice donor site probably null
R2519:Stab1 UTSW 14 31154872 missense probably damaging 1.00
R2926:Stab1 UTSW 14 31161799 missense probably damaging 1.00
R4025:Stab1 UTSW 14 31154952 missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31168479 missense probably damaging 0.98
R4258:Stab1 UTSW 14 31154672 missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31157445 missense probably benign 0.01
R4644:Stab1 UTSW 14 31140487 unclassified probably benign
R4660:Stab1 UTSW 14 31154915 missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31141371 nonsense probably null
R4802:Stab1 UTSW 14 31141371 nonsense probably null
R4870:Stab1 UTSW 14 31142043 missense probably benign 0.13
R4872:Stab1 UTSW 14 31140393 missense probably damaging 1.00
R4881:Stab1 UTSW 14 31143672 missense probably benign 0.32
R4941:Stab1 UTSW 14 31151571 missense probably benign 0.00
R5061:Stab1 UTSW 14 31163099 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31143624 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5087:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5092:Stab1 UTSW 14 31145855 missense probably benign 0.01
R5102:Stab1 UTSW 14 31148017 critical splice donor site probably null
R5107:Stab1 UTSW 14 31163795 splice site probably null
R5195:Stab1 UTSW 14 31140521 unclassified probably benign
R5217:Stab1 UTSW 14 31159519 missense probably benign 0.25
R5285:Stab1 UTSW 14 31143476 unclassified probably benign
R5327:Stab1 UTSW 14 31161836 nonsense probably null
R5647:Stab1 UTSW 14 31157440 nonsense probably null
R5696:Stab1 UTSW 14 31160221 missense probably benign
R5996:Stab1 UTSW 14 31139551 missense probably benign 0.39
R6016:Stab1 UTSW 14 31158993 missense probably damaging 1.00
R6017:Stab1 UTSW 14 31141544 missense probably benign 0.00
R6174:Stab1 UTSW 14 31162519 nonsense probably null
R6366:Stab1 UTSW 14 31141438 missense probably benign 0.10
R6754:Stab1 UTSW 14 31141081 missense probably benign
R6788:Stab1 UTSW 14 31139160 missense probably damaging 1.00
R6898:Stab1 UTSW 14 31158963 missense probably benign 0.00
R7124:Stab1 UTSW 14 31160867 missense possibly damaging 0.94
R7145:Stab1 UTSW 14 31145073 critical splice donor site probably null
R7213:Stab1 UTSW 14 31143673 missense probably benign
R7215:Stab1 UTSW 14 31160797 missense possibly damaging 0.93
R7319:Stab1 UTSW 14 31140826 missense probably damaging 1.00
R7389:Stab1 UTSW 14 31147239 missense probably benign 0.00
R7400:Stab1 UTSW 14 31157384 missense probably null 1.00
R7427:Stab1 UTSW 14 31159259 missense probably benign 0.00
R7428:Stab1 UTSW 14 31159259 missense probably benign 0.00
R7484:Stab1 UTSW 14 31160317 missense probably benign 0.00
R7568:Stab1 UTSW 14 31152595 missense probably damaging 1.00
R7574:Stab1 UTSW 14 31154665 missense probably benign
R7619:Stab1 UTSW 14 31145237 missense probably benign
R7623:Stab1 UTSW 14 31140621 missense probably benign 0.03
R7721:Stab1 UTSW 14 31141456 missense possibly damaging 0.48
R7869:Stab1 UTSW 14 31154472 missense probably benign 0.01
R7936:Stab1 UTSW 14 31157415 missense possibly damaging 0.88
R7956:Stab1 UTSW 14 31160024 missense probably benign 0.02
R7973:Stab1 UTSW 14 31159633 critical splice donor site probably null
R8059:Stab1 UTSW 14 31160241 missense probably benign 0.02
R8116:Stab1 UTSW 14 31158953 missense possibly damaging 0.80
R8304:Stab1 UTSW 14 31148954 missense probably benign 0.14
R8368:Stab1 UTSW 14 31148411 missense possibly damaging 0.91
R8495:Stab1 UTSW 14 31155833 missense probably damaging 1.00
R8513:Stab1 UTSW 14 31149790 critical splice donor site probably null
R8544:Stab1 UTSW 14 31163051 nonsense probably null
R8671:Stab1 UTSW 14 31157408 missense probably damaging 1.00
R8885:Stab1 UTSW 14 31161814 missense possibly damaging 0.79
R8974:Stab1 UTSW 14 31160822 missense probably benign
R9022:Stab1 UTSW 14 31160269 missense probably benign 0.01
R9059:Stab1 UTSW 14 31154848 missense probably benign 0.01
R9226:Stab1 UTSW 14 31145855 missense probably benign 0.00
R9272:Stab1 UTSW 14 31145341 missense probably benign 0.05
R9388:Stab1 UTSW 14 31154355 missense probably damaging 1.00
R9401:Stab1 UTSW 14 31161112 missense probably benign
R9433:Stab1 UTSW 14 31143574 missense probably benign 0.00
R9450:Stab1 UTSW 14 31162939 missense possibly damaging 0.62
R9505:Stab1 UTSW 14 31155765 missense probably damaging 1.00
R9570:Stab1 UTSW 14 31142681 missense probably benign 0.01
X0026:Stab1 UTSW 14 31162191 missense possibly damaging 0.91
Z1176:Stab1 UTSW 14 31142038 missense probably benign 0.00
Z1176:Stab1 UTSW 14 31150660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTGTGGATGCTGAACTG -3'
(R):5'- CCTTCCCTTTGAGACTGTGG -3'

Sequencing Primer
(F):5'- TCTCTGATGAGATAGACACTGGAC -3'
(R):5'- ACTGTGGTCGGCAAAGC -3'
Posted On 2019-05-15