Incidental Mutation 'PIT4280001:Nlrp12'
ID554410
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene NameNLR family, pyrin domain containing 12
SynonymsNalp12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #PIT4280001 (G1)
Quality Score163.009
Status Not validated
Chromosome7
Chromosomal Location3218784-3249740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3241433 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 150 (C150S)
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108653
AA Change: C150S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: C150S

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.9%
  • 10x: 85.5%
  • 20x: 73.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik A G 11: 83,440,834 D161G probably damaging Het
2810474O19Rik T G 6: 149,325,525 I23S probably benign Het
Acer2 C T 4: 86,887,083 L95F probably damaging Het
Adam15 C T 3: 89,343,978 probably null Het
Bmi1 T A 2: 18,683,009 Y98* probably null Het
Cdon T C 9: 35,486,935 C983R probably damaging Het
Col12a1 T C 9: 79,678,105 R1297G probably damaging Het
Cpd A T 11: 76,791,024 M1132K probably benign Het
Dnah17 T A 11: 118,098,582 R1267W possibly damaging Het
Dnah9 G A 11: 66,005,013 A2512V probably benign Het
Eri3 G A 4: 117,582,634 G175D probably damaging Het
Fbxo9 C A 9: 78,087,511 W244L probably damaging Het
Fgfr3 A T 5: 33,732,232 H343L probably benign Het
Fmnl2 G A 2: 53,118,196 A803T unknown Het
Fmnl3 A G 15: 99,321,253 probably null Het
Fth1 C A 19: 9,984,609 A104E probably damaging Het
Gcm1 T C 9: 78,059,633 Y45H probably damaging Het
Gm5157 C G 7: 21,185,082 G179R probably damaging Het
Gpr179 A G 11: 97,344,115 I463T probably damaging Het
Gpr35 T C 1: 92,982,634 Y23H probably damaging Het
Inpp4b C T 8: 82,034,417 H647Y probably benign Het
Kif6 A T 17: 49,755,120 K436M probably benign Het
Lacc1 T A 14: 77,035,077 Q93L probably damaging Het
Lamc1 T C 1: 153,243,471 R801G probably damaging Het
Lrp2bp T G 8: 46,023,011 V263G probably damaging Het
Maats1 C T 16: 38,332,773 V160I probably benign Het
Magi3 T A 3: 104,054,352 K453N probably damaging Het
Mfsd6 T A 1: 52,660,880 Y703F probably benign Het
Mms22l A G 4: 24,581,149 T820A probably benign Het
Ndufa12 T C 10: 94,199,132 probably null Het
Noc4l G A 5: 110,651,439 T159I probably benign Het
Olfml2b T A 1: 170,647,736 C77S probably damaging Het
Olfr1259 A T 2: 89,943,743 I124N probably damaging Het
Olfr460 C A 6: 40,571,716 T110K probably damaging Het
Pdzd2 A G 15: 12,399,288 V784A probably damaging Het
Pip5kl1 A T 2: 32,583,458 Y369F probably benign Het
Pkdrej A T 15: 85,819,935 I600N probably benign Het
Psg19 T C 7: 18,796,906 I108V probably damaging Het
Pxdn G A 12: 29,995,328 V539M probably damaging Het
Rsbn1l T A 5: 20,919,655 H383L probably damaging Het
Scamp2 A T 9: 57,580,793 N118I probably damaging Het
Scn2a T C 2: 65,715,730 V879A probably damaging Het
Scn8a G A 15: 100,957,489 E172K probably damaging Het
Slc16a6 C T 11: 109,458,593 C214Y possibly damaging Het
Stag1 A G 9: 100,942,716 T922A possibly damaging Het
Svs1 A T 6: 48,987,120 M21L probably benign Het
Tarbp1 T C 8: 126,430,847 H1307R probably damaging Het
Tut1 T G 19: 8,959,262 V150G probably benign Het
Ubr2 G A 17: 46,944,863 R1371W probably damaging Het
Vmn2r124 A G 17: 18,063,225 N394D probably benign Het
Vmn2r63 T C 7: 42,903,985 T616A probably damaging Het
Zp3 G A 5: 135,984,464 V217M possibly damaging Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3240757 missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3240092 missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3240686 missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3235160 missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3239833 missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3233944 missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3249545 utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3240464 missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3240967 missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3245350 missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3240092 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3240034 missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3234029 missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3249377 missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3249262 missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3228534 missense probably benign
R1680:Nlrp12 UTSW 7 3241174 missense probably damaging 1.00
R2030:Nlrp12 UTSW 7 3228417 missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3233195 missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3241449 missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3233945 missense probably benign 0.00
R3615:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R3616:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3239924 missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3231061 missense probably damaging 1.00
R4856:Nlrp12 UTSW 7 3240442 missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5147:Nlrp12 UTSW 7 3241373 missense possibly damaging 0.79
R5505:Nlrp12 UTSW 7 3249385 missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3225294 missense probably damaging 0.99
R5891:Nlrp12 UTSW 7 3219259 utr 3 prime probably benign
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3239888 missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3234043 missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3241409 missense probably damaging 1.00
R6886:Nlrp12 UTSW 7 3240683 missense probably benign 0.03
R6957:Nlrp12 UTSW 7 3222486 missense probably damaging 1.00
R6995:Nlrp12 UTSW 7 3239851 missense probably benign
R7340:Nlrp12 UTSW 7 3233125 missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3249257 missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3241201 missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3241347 missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3222539 missense probably benign 0.14
R7729:Nlrp12 UTSW 7 3228388 critical splice donor site probably null
R7793:Nlrp12 UTSW 7 3245400 missense probably benign
X0064:Nlrp12 UTSW 7 3241386 missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGTTCTTCGTCTGGCTCAAA -3'
(R):5'- AGAAAGAAACTCTGTCTTAAGGGG -3'

Sequencing Primer
(F):5'- CTCAAAGAGGGTCTCCATTTGGATAG -3'
(R):5'- GGATCTGAGTTCGATTACCAGCAC -3'
Posted On2019-06-07