Mutagenetix > Incidental Mutation

Incidental Mutation 'R3616:Nlrp12'

268396

Institutional Source

Beutler Lab

Gene Symbol

Nlrp12

Ensembl Gene

ENSMUSG00000078817

Gene Name

NLR family, pyrin domain containing 12

Synonyms

Nalp12

MMRRC Submission

040673-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R3616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3218784-3249740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3240575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 436 (M436L)

Ref Sequence

ENSEMBL: ENSMUSP00000104293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108653]

AlphaFold

E9Q5R7

Predicted Effect

probably benign
Transcript: ENSMUST00000108653
AA Change: M436L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: M436L

Domain	Start	End	E-Value	Type
PYRIN	9	91	1.84e-24	SMART
FISNA	128	201	1.71e-24	SMART
Pfam:NACHT	211	381	4.2e-52	PFAM
LRR	705	732	6.78e-3	SMART
LRR	734	761	2.13e1	SMART
LRR	762	789	3.49e-5	SMART
LRR	791	818	7.02e0	SMART
LRR	819	846	6.52e-5	SMART
LRR	848	875	6.92e-1	SMART
LRR	876	903	2.47e-5	SMART
LRR	905	932	3.78e0	SMART
LRR	933	960	1.63e-5	SMART
LRR	962	989	4.9e0	SMART
LRR	990	1017	1.79e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205233

Meta Mutation Damage Score

0.0656

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (29/29)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
A2ml1	T	C	6: 128,558,294	T818A	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Ap2b1	T	A	11: 83,324,565	C112S	possibly damaging	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Dzip3	A	G	16: 48,937,063	L869S	probably damaging	Het
Efs	T	C	14: 54,920,095	Y160C	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Kif1b	A	T	4: 149,262,283		probably benign	Het
Krt25	A	C	11: 99,317,298	V368G	possibly damaging	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp10	A	G	7: 108,924,476	F599S	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pard6b	T	C	2: 168,087,339		probably benign	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Psap	A	G	10: 60,294,603	N149S	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in Nlrp12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00733:Nlrp12	APN	7	3240757	missense	probably damaging	1.00
IGL01301:Nlrp12	APN	7	3240092	missense	probably damaging	1.00
IGL01346:Nlrp12	APN	7	3240686	missense	probably damaging	1.00
IGL01482:Nlrp12	APN	7	3235160	missense	possibly damaging	0.65
IGL01534:Nlrp12	APN	7	3239833	missense	probably benign	0.03
IGL02106:Nlrp12	APN	7	3233944	missense	probably benign	0.02
IGL02159:Nlrp12	APN	7	3249545	utr 5 prime	probably benign
IGL02184:Nlrp12	APN	7	3240464	missense	probably damaging	0.99
IGL02221:Nlrp12	APN	7	3240967	missense	possibly damaging	0.89
IGL02252:Nlrp12	APN	7	3245350	missense	probably benign	0.01
ANU18:Nlrp12	UTSW	7	3240092	missense	probably damaging	1.00
PIT4280001:Nlrp12	UTSW	7	3241433	missense	possibly damaging	0.94
R0033:Nlrp12	UTSW	7	3240407	missense	probably damaging	1.00
R0033:Nlrp12	UTSW	7	3240407	missense	probably damaging	1.00
R0090:Nlrp12	UTSW	7	3240034	missense	probably damaging	0.99
R0446:Nlrp12	UTSW	7	3234029	missense	probably benign	0.00
R0503:Nlrp12	UTSW	7	3249377	missense	probably damaging	0.97
R0538:Nlrp12	UTSW	7	3249262	missense	possibly damaging	0.56
R1114:Nlrp12	UTSW	7	3228534	missense	probably benign
R1680:Nlrp12	UTSW	7	3241174	missense	probably damaging	1.00
R2030:Nlrp12	UTSW	7	3228417	missense	probably damaging	1.00
R2096:Nlrp12	UTSW	7	3233195	missense	probably benign	0.05
R2118:Nlrp12	UTSW	7	3241449	missense	probably damaging	1.00
R2266:Nlrp12	UTSW	7	3233945	missense	probably benign	0.00
R3615:Nlrp12	UTSW	7	3240575	missense	probably benign	0.00
R4375:Nlrp12	UTSW	7	3240946	missense	possibly damaging	0.88
R4376:Nlrp12	UTSW	7	3240946	missense	possibly damaging	0.88
R4379:Nlrp12	UTSW	7	3239924	missense	probably benign	0.08
R4837:Nlrp12	UTSW	7	3231061	missense	probably damaging	1.00
R4856:Nlrp12	UTSW	7	3240442	missense	probably damaging	1.00
R4970:Nlrp12	UTSW	7	3240983	missense	possibly damaging	0.72
R5112:Nlrp12	UTSW	7	3240983	missense	possibly damaging	0.72
R5147:Nlrp12	UTSW	7	3241373	missense	possibly damaging	0.79
R5505:Nlrp12	UTSW	7	3249385	missense	probably damaging	0.99
R5636:Nlrp12	UTSW	7	3225294	missense	probably damaging	0.99
R5891:Nlrp12	UTSW	7	3219259	utr 3 prime	probably benign
R6039:Nlrp12	UTSW	7	3241372	missense	possibly damaging	0.79
R6039:Nlrp12	UTSW	7	3241372	missense	possibly damaging	0.79
R6365:Nlrp12	UTSW	7	3239888	missense	probably benign	0.00
R6383:Nlrp12	UTSW	7	3234043	missense	probably damaging	1.00
R6796:Nlrp12	UTSW	7	3241409	missense	probably damaging	1.00
R6886:Nlrp12	UTSW	7	3240683	missense	probably benign	0.03
R6957:Nlrp12	UTSW	7	3222486	missense	probably damaging	1.00
R6995:Nlrp12	UTSW	7	3239851	missense	probably benign
R7340:Nlrp12	UTSW	7	3233125	missense	possibly damaging	0.93
R7346:Nlrp12	UTSW	7	3249257	missense	probably damaging	0.96
R7387:Nlrp12	UTSW	7	3241201	missense	probably damaging	0.97
R7414:Nlrp12	UTSW	7	3241347	missense	probably benign	0.01
R7432:Nlrp12	UTSW	7	3222539	missense	probably benign	0.14
R7729:Nlrp12	UTSW	7	3228388	critical splice donor site	probably null
R7793:Nlrp12	UTSW	7	3245400	missense	probably benign
R8257:Nlrp12	UTSW	7	3249332	missense	probably damaging	1.00
R8357:Nlrp12	UTSW	7	3240805	missense	probably damaging	1.00
R8457:Nlrp12	UTSW	7	3240805	missense	probably damaging	1.00
R8558:Nlrp12	UTSW	7	3249481	missense	probably damaging	1.00
R8826:Nlrp12	UTSW	7	3240991	missense	possibly damaging	0.79
R9480:Nlrp12	UTSW	7	3240363	nonsense	probably null
X0064:Nlrp12	UTSW	7	3241386	missense	probably benign	0.14
X0065:Nlrp12	UTSW	7	3240575	missense	probably benign	0.00
Z1088:Nlrp12	UTSW	7	3222537	missense	probably benign	0.00
Z1176:Nlrp12	UTSW	7	3222537	missense	probably benign	0.00
Z1177:Nlrp12	UTSW	7	3222537	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCACGTTGAGGAAAGTGGAC -3'
(R):5'- TCTCCGAGGAAGCTAGGAAG -3'

Sequencing Primer
(F):5'- AGTGGACACATCTGCTCCATCTAG -3'
(R):5'- TCTACAGATATTTCCACAACACTGG -3'

Posted On

2015-02-19