Incidental Mutation 'R3616:Nlrp12'
ID268396
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene NameNLR family, pyrin domain containing 12
SynonymsNalp12
MMRRC Submission 040673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R3616 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3218784-3249740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3240575 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 436 (M436L)
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
Predicted Effect probably benign
Transcript: ENSMUST00000108653
AA Change: M436L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: M436L

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205233
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,864 N399S probably benign Het
A2ml1 T C 6: 128,558,294 T818A probably benign Het
Aasdh A G 5: 76,888,782 V304A probably benign Het
Angptl3 G A 4: 99,034,465 A248T probably benign Het
Ap2b1 T A 11: 83,324,565 C112S possibly damaging Het
Aqr A T 2: 114,136,887 I549N probably damaging Het
Barhl1 C T 2: 28,911,550 D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 V821A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dnah1 A G 14: 31,315,148 L247P possibly damaging Het
Dpysl2 T A 14: 66,834,370 H107L probably damaging Het
Dzip3 A G 16: 48,937,063 L869S probably damaging Het
Efs T C 14: 54,920,095 Y160C probably damaging Het
Enam A T 5: 88,504,447 N1197Y possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam184b A G 5: 45,582,815 V343A possibly damaging Het
Fbxw26 A T 9: 109,743,760 Y105* probably null Het
Fiz1 A G 7: 5,008,172 L449P probably benign Het
Foxi2 T A 7: 135,410,451 C23S possibly damaging Het
Gdf2 G A 14: 33,944,957 R212Q probably damaging Het
Gm5105 C A 3: 138,049,688 A46S unknown Het
Gm597 T C 1: 28,776,575 D792G probably benign Het
Grik5 C T 7: 25,022,571 A581T probably benign Het
Gse1 C G 8: 120,572,742 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Kif1b A T 4: 149,262,283 probably benign Het
Krt25 A C 11: 99,317,298 V368G possibly damaging Het
Lacc1 A G 14: 77,033,287 V269A probably benign Het
Lamc1 T C 1: 153,251,150 K417E probably damaging Het
Miip A G 4: 147,865,914 M75T probably benign Het
Nlrp10 A G 7: 108,924,476 F599S probably benign Het
Olfr142 T C 2: 90,252,409 E193G possibly damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Pard6b T C 2: 168,087,339 probably benign Het
Pla2g2e G A 4: 138,880,374 V22I probably benign Het
Plekhd1 A G 12: 80,717,270 E202G probably damaging Het
Prss21 A G 17: 23,872,831 T258A probably benign Het
Prss34 A G 17: 25,298,846 E65G probably benign Het
Psap A G 10: 60,294,603 N149S probably benign Het
Ptprf C T 4: 118,237,883 A275T probably benign Het
Sem1 A G 6: 6,578,520 L12P probably damaging Het
Sf3b3 A G 8: 110,844,523 Y4H probably damaging Het
Sh3bp4 G T 1: 89,137,705 R7L probably damaging Het
Slc16a1 T A 3: 104,653,570 L397Q probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Tas2r102 C T 6: 132,762,818 Q230* probably null Het
Tdo2 A G 3: 81,975,428 Y13H possibly damaging Het
Tmem231 C T 8: 111,918,313 R187H possibly damaging Het
Tmem30b A G 12: 73,545,579 M254T probably damaging Het
Trpm1 G A 7: 64,243,570 G1057R probably damaging Het
Tusc3 A T 8: 39,164,838 K347N probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Vash2 T C 1: 190,970,419 Y117C probably damaging Het
Vrk2 A G 11: 26,489,866 I235T possibly damaging Het
Wdr20 A G 12: 110,793,939 T420A probably benign Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3240757 missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3240092 missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3240686 missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3235160 missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3239833 missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3233944 missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3249545 utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3240464 missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3240967 missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3245350 missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3240092 missense probably damaging 1.00
PIT4280001:Nlrp12 UTSW 7 3241433 missense possibly damaging 0.94
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3240034 missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3234029 missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3249377 missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3249262 missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3228534 missense probably benign
R1680:Nlrp12 UTSW 7 3241174 missense probably damaging 1.00
R2030:Nlrp12 UTSW 7 3228417 missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3233195 missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3241449 missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3233945 missense probably benign 0.00
R3615:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3239924 missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3231061 missense probably damaging 1.00
R4856:Nlrp12 UTSW 7 3240442 missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5147:Nlrp12 UTSW 7 3241373 missense possibly damaging 0.79
R5505:Nlrp12 UTSW 7 3249385 missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3225294 missense probably damaging 0.99
R5891:Nlrp12 UTSW 7 3219259 utr 3 prime probably benign
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3239888 missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3234043 missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3241409 missense probably damaging 1.00
R6886:Nlrp12 UTSW 7 3240683 missense probably benign 0.03
R6957:Nlrp12 UTSW 7 3222486 missense probably damaging 1.00
R6995:Nlrp12 UTSW 7 3239851 missense probably benign
R7340:Nlrp12 UTSW 7 3233125 missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3249257 missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3241201 missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3241347 missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3222539 missense probably benign 0.14
R7729:Nlrp12 UTSW 7 3228388 critical splice donor site probably null
R7793:Nlrp12 UTSW 7 3245400 missense probably benign
R8257:Nlrp12 UTSW 7 3249332 missense probably damaging 1.00
R8357:Nlrp12 UTSW 7 3240805 missense probably damaging 1.00
X0064:Nlrp12 UTSW 7 3241386 missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1176:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1177:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCACGTTGAGGAAAGTGGAC -3'
(R):5'- TCTCCGAGGAAGCTAGGAAG -3'

Sequencing Primer
(F):5'- AGTGGACACATCTGCTCCATCTAG -3'
(R):5'- TCTACAGATATTTCCACAACACTGG -3'
Posted On2015-02-19