Incidental Mutation 'PIT4366001:Ptcd1'
ID554757
Institutional Source Beutler Lab
Gene Symbol Ptcd1
Ensembl Gene ENSMUSG00000029624
Gene Namepentatricopeptide repeat domain 1
Synonyms1110069M14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #PIT4366001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location145147514-145167108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145151335 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 622 (V622A)
Ref Sequence ENSEMBL: ENSMUSP00000031628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031628] [ENSMUST00000159018] [ENSMUST00000160075] [ENSMUST00000162308] [ENSMUST00000162594]
Predicted Effect probably benign
Transcript: ENSMUST00000031628
AA Change: V622A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031628
Gene: ENSMUSG00000029624
AA Change: V622A

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
low complexity region 64 74 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
Pfam:PPR_2 169 218 1.2e-16 PFAM
Pfam:PPR 172 202 1.1e-9 PFAM
Pfam:PPR_3 173 204 2.5e-5 PFAM
Pfam:PPR_3 245 278 3.2e-5 PFAM
Pfam:PPR 246 276 6.5e-4 PFAM
internal_repeat_1 437 595 1.57e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159018
SMART Domains Protein: ENSMUSP00000124999
Gene: ENSMUSG00000038722

DomainStartEndE-ValueType
Pfam:G10 1 144 2.2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160075
SMART Domains Protein: ENSMUSP00000125564
Gene: ENSMUSG00000038722

DomainStartEndE-ValueType
Pfam:G10 1 144 2.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162308
SMART Domains Protein: ENSMUSP00000125590
Gene: ENSMUSG00000038722

DomainStartEndE-ValueType
Pfam:G10 29 103 9.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162594
SMART Domains Protein: ENSMUSP00000125738
Gene: ENSMUSG00000038722

DomainStartEndE-ValueType
Pfam:G10 1 144 2.2e-69 PFAM
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents naturally occurring read-through transcription between the ATP5J2 (ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2) and PTCD1 (pentatricopeptide repeat domain 1) genes on chromosome 7. The read-through transcript encodes a fusion protein that shares sequence identity with each individual gene product. [provided by RefSeq, Nov 2010]
PHENOTYPE: Knockout affects mitochondrial protein synthesis and RNA metabolism. Homozygous KO is embryonic lethal. Heterozygous KO causes adult onset obesity, liver fibrosis and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Ptcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Ptcd1 APN 5 145151282 unclassified probably benign
IGL00984:Ptcd1 APN 5 145165429 missense probably benign
IGL01120:Ptcd1 APN 5 145152243 unclassified probably benign
IGL01545:Ptcd1 APN 5 145159536 missense probably damaging 1.00
IGL01861:Ptcd1 APN 5 145158777 missense possibly damaging 0.81
IGL02543:Ptcd1 APN 5 145154687 missense possibly damaging 0.66
IGL02835:Ptcd1 UTSW 5 145154690 missense possibly damaging 0.78
PIT4494001:Ptcd1 UTSW 5 145155358 missense probably benign 0.01
R3001:Ptcd1 UTSW 5 145159576 missense probably damaging 0.98
R3002:Ptcd1 UTSW 5 145159576 missense probably damaging 0.98
R4460:Ptcd1 UTSW 5 145159506 missense probably benign 0.25
R4587:Ptcd1 UTSW 5 145154721 missense possibly damaging 0.47
R4652:Ptcd1 UTSW 5 145155175 missense probably benign 0.01
R5059:Ptcd1 UTSW 5 145152224 missense probably benign 0.07
R5364:Ptcd1 UTSW 5 145151431 missense probably damaging 0.99
R5367:Ptcd1 UTSW 5 145147905 utr 3 prime probably benign
R5733:Ptcd1 UTSW 5 145154861 missense probably damaging 1.00
R5800:Ptcd1 UTSW 5 145159665 missense probably damaging 0.99
R6281:Ptcd1 UTSW 5 145165071 missense probably benign 0.10
R6931:Ptcd1 UTSW 5 145155075 missense probably benign 0.00
R7472:Ptcd1 UTSW 5 145154730 missense possibly damaging 0.94
R7723:Ptcd1 UTSW 5 145154829 missense probably damaging 1.00
R7731:Ptcd1 UTSW 5 145151364 missense probably benign 0.07
R8048:Ptcd1 UTSW 5 145155077 missense probably benign
R8090:Ptcd1 UTSW 5 145159535 missense possibly damaging 0.91
Z1177:Ptcd1 UTSW 5 145165435 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAAACCTATGGGCTGGAGCG -3'
(R):5'- CACCCTTGTTCTAGCAGACTGC -3'

Sequencing Primer
(F):5'- CCAGAGTGAGTGGGGCTG -3'
(R):5'- AGACTGCGTTGTCCTTCCAG -3'
Posted On2019-06-07