Incidental Mutation 'R7298:Olfr303'
ID566797
Institutional Source Beutler Lab
Gene Symbol Olfr303
Ensembl Gene ENSMUSG00000039608
Gene Nameolfactory receptor 303
SynonymsGA_x6K02T2NHDJ-9712819-9713778, MOR104-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86391810-86397789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86394923 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 192 (T192S)
Ref Sequence ENSEMBL: ENSMUSP00000148852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053958] [ENSMUST00000215234] [ENSMUST00000215532] [ENSMUST00000215733] [ENSMUST00000216409]
Predicted Effect probably damaging
Transcript: ENSMUST00000053958
AA Change: T192S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062459
Gene: ENSMUSG00000039608
AA Change: T192S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-52 PFAM
Pfam:7tm_1 41 307 4.9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215234
AA Change: T192S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215532
AA Change: T192S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215733
AA Change: T192S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216409
AA Change: T192S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cfap44 A T 16: 44,481,412 M1838L probably benign Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Fam151a G T 4: 106,735,528 R69L possibly damaging Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Hacl1 A T 14: 31,616,486 M378K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Ranbp9 A G 13: 43,480,460 F157L probably benign Het
Rbbp6 A G 7: 123,001,194 K1475E unknown Het
Retnlg A G 16: 48,872,874 N5D probably benign Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Scrib A C 15: 76,064,761 V447G probably damaging Het
Slc22a6 C A 19: 8,621,320 A247E possibly damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp346 T G 13: 55,130,603 V258G probably damaging Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Zgrf1 C A 3: 127,583,650 S848* probably null Het
Other mutations in Olfr303
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02228:Olfr303 APN 7 86395078 missense possibly damaging 0.50
IGL02902:Olfr303 APN 7 86394535 utr 3 prime probably benign
IGL02937:Olfr303 APN 7 86394590 missense possibly damaging 0.89
R1455:Olfr303 UTSW 7 86394595 missense probably damaging 0.97
R1524:Olfr303 UTSW 7 86394812 missense probably benign 0.01
R1762:Olfr303 UTSW 7 86395145 missense probably damaging 0.97
R3014:Olfr303 UTSW 7 86394676 missense probably benign 0.19
R3027:Olfr303 UTSW 7 86394553 missense probably benign 0.00
R4073:Olfr303 UTSW 7 86394947 missense probably damaging 0.98
R4502:Olfr303 UTSW 7 86395277 missense possibly damaging 0.49
R4503:Olfr303 UTSW 7 86395277 missense possibly damaging 0.49
R4607:Olfr303 UTSW 7 86394510 utr 3 prime probably null
R4608:Olfr303 UTSW 7 86394510 utr 3 prime probably null
R7134:Olfr303 UTSW 7 86395544 start gained probably benign
R7827:Olfr303 UTSW 7 86394557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTACTGTGAGATGGGAGGC -3'
(R):5'- TAGCAGTTATGGCTTATGACAGG -3'

Sequencing Primer
(F):5'- GGCACAAGTTGAGAATGTTTTCTTCC -3'
(R):5'- GCTTATGACAGGCATGTGGC -3'
Posted On2019-06-26