Incidental Mutation 'R7300:Olfr135'
ID566946
Institutional Source Beutler Lab
Gene Symbol Olfr135
Ensembl Gene ENSMUSG00000057801
Gene Nameolfactory receptor 135
SynonymsGA_x6K02T2PSCP-2656648-2657586, MOR256-48
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location38204335-38210915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38208697 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 151 (T151P)
Ref Sequence ENSEMBL: ENSMUSP00000150535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076245] [ENSMUST00000213217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076245
AA Change: T151P

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075595
Gene: ENSMUSG00000057801
AA Change: T151P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.6e-50 PFAM
Pfam:7tm_1 41 290 9.2e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213217
AA Change: T151P

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Olfr135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr135 APN 17 38208982 missense probably damaging 0.99
IGL01316:Olfr135 APN 17 38208497 missense probably damaging 0.98
IGL01666:Olfr135 APN 17 38208889 missense probably benign 0.11
IGL02096:Olfr135 APN 17 38209183 makesense probably null
R0255:Olfr135 UTSW 17 38208395 missense probably benign
R0630:Olfr135 UTSW 17 38208413 missense probably damaging 0.97
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1279:Olfr135 UTSW 17 38208787 missense probably benign 0.01
R1878:Olfr135 UTSW 17 38208374 missense probably benign 0.03
R1969:Olfr135 UTSW 17 38208464 missense probably damaging 1.00
R2374:Olfr135 UTSW 17 38209067 missense probably damaging 0.97
R3708:Olfr135 UTSW 17 38208283 missense probably benign 0.01
R5025:Olfr135 UTSW 17 38208443 missense probably damaging 1.00
R5093:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5095:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5103:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5104:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5105:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5149:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5150:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5344:Olfr135 UTSW 17 38209104 missense probably damaging 1.00
R6608:Olfr135 UTSW 17 38208479 missense probably damaging 1.00
R7324:Olfr135 UTSW 17 38208716 missense probably benign
R7580:Olfr135 UTSW 17 38209043 missense probably benign 0.11
R8062:Olfr135 UTSW 17 38209174 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGACCATCAGCTACTTGAGG -3'
(R):5'- TCCAATACTAGCATAGGAGGCAAG -3'

Sequencing Primer
(F):5'- CAGCTACTTGAGGTGTGTAGTTCAG -3'
(R):5'- CTAGCATAGGAGGCAAGAATTAAAC -3'
Posted On2019-06-26