Incidental Mutation 'R7300:Vmn2r31'
ID566921
Institutional Source Beutler Lab
Gene Symbol Vmn2r31
Ensembl Gene ENSMUSG00000096373
Gene Namevomeronasal 2, receptor 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7300 (G1)
Quality Score183.009
Status Validated
Chromosome7
Chromosomal Location7383027-7399743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7384776 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 599 (A599S)
Ref Sequence ENSEMBL: ENSMUSP00000074613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075108]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075108
AA Change: A599S

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074613
Gene: ENSMUSG00000096373
AA Change: A599S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1e-33 PFAM
Pfam:NCD3G 512 565 1.4e-20 PFAM
Pfam:7tm_3 598 833 8.1e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Vmn2r31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Vmn2r31 APN 7 7396566 missense probably damaging 0.98
IGL01536:Vmn2r31 APN 7 7384848 missense probably damaging 1.00
IGL01985:Vmn2r31 APN 7 7394511 missense probably benign
IGL02116:Vmn2r31 APN 7 7394549 missense probably damaging 0.97
FR4304:Vmn2r31 UTSW 7 7384608 missense probably damaging 1.00
R1609:Vmn2r31 UTSW 7 7384889 missense probably damaging 1.00
R4647:Vmn2r31 UTSW 7 7384368 missense probably damaging 1.00
R4724:Vmn2r31 UTSW 7 7384758 missense possibly damaging 0.63
R4824:Vmn2r31 UTSW 7 7387063 critical splice donor site probably null
R5619:Vmn2r31 UTSW 7 7384530 nonsense probably null
R6225:Vmn2r31 UTSW 7 7394639 missense probably benign 0.19
R6610:Vmn2r31 UTSW 7 7384589 missense probably damaging 0.97
R6956:Vmn2r31 UTSW 7 7394506 missense probably benign
R7111:Vmn2r31 UTSW 7 7396481 missense probably damaging 0.99
R7219:Vmn2r31 UTSW 7 7387106 missense probably benign
R7219:Vmn2r31 UTSW 7 7394398 missense probably damaging 0.97
R7395:Vmn2r31 UTSW 7 7384745 missense probably damaging 1.00
R7481:Vmn2r31 UTSW 7 7384580 missense possibly damaging 0.94
R8015:Vmn2r31 UTSW 7 7384200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACAGTGACTGTTTTGGC -3'
(R):5'- AGACCTAACTAAGCTTTCCTTTGG -3'

Sequencing Primer
(F):5'- CACAGTGACTGTTTTGGCCAGAAC -3'
(R):5'- TGGAAATCAGATATGGATCAATGTG -3'
Posted On2019-06-26