Incidental Mutation 'R7300:Sim1'
ID566932
Institutional Source Beutler Lab
Gene Symbol Sim1
Ensembl Gene ENSMUSG00000019913
Gene Namesingle-minded family bHLH transcription factor 1
SynonymsbHLHe14
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location50894754-50989152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50909518 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 228 (H228Y)
Ref Sequence ENSEMBL: ENSMUSP00000020071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020071]
Predicted Effect probably benign
Transcript: ENSMUST00000020071
AA Change: H228Y

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020071
Gene: ENSMUSG00000019913
AA Change: H228Y

DomainStartEndE-ValueType
HLH 6 59 8.73e-6 SMART
PAS 79 145 7.39e-14 SMART
PAS 220 286 5.61e-5 SMART
PAC 292 335 4.63e-6 SMART
Pfam:SIM_C 359 668 2.5e-114 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIM1 and SIM2 genes are Drosophila single-minded (sim) gene homologs. SIM1 transcript was detected only in fetal kidney out of various adult and fetal tissues tested. Since the sim gene plays an important role in Drosophila development and has peak levels of expression during the period of neurogenesis,it was proposed that the human SIM gene is a candidate for involvement in certain dysmorphic features (particularly the facial and skull characteristics), abnormalities of brain development, and/or mental retardation of Down syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with abnormalities in the paraventricular and supraoptic nuclei. Heterozygous mutant mice are obese and may also be diabetic, hyperinsulinemic and insulin resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Sim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Sim1 APN 10 50981534 missense probably damaging 0.99
IGL01142:Sim1 APN 10 50910671 missense probably damaging 0.99
IGL01886:Sim1 APN 10 50984315 missense probably damaging 1.00
PIT4585001:Sim1 UTSW 10 50984188 nonsense probably null
R0128:Sim1 UTSW 10 50907961 missense probably damaging 1.00
R0130:Sim1 UTSW 10 50907961 missense probably damaging 1.00
R0717:Sim1 UTSW 10 50909828 missense probably damaging 1.00
R0948:Sim1 UTSW 10 50981327 nonsense probably null
R1169:Sim1 UTSW 10 50981522 missense probably benign 0.13
R1388:Sim1 UTSW 10 50895994 missense probably damaging 1.00
R1746:Sim1 UTSW 10 50984109 missense probably benign
R1778:Sim1 UTSW 10 50981553 nonsense probably null
R1834:Sim1 UTSW 10 50909828 missense probably damaging 1.00
R2434:Sim1 UTSW 10 50907958 missense probably damaging 1.00
R2919:Sim1 UTSW 10 50909815 missense probably benign 0.23
R3617:Sim1 UTSW 10 50909528 missense probably damaging 1.00
R3625:Sim1 UTSW 10 50981336 missense probably benign 0.30
R4152:Sim1 UTSW 10 50983854 missense probably damaging 0.98
R4414:Sim1 UTSW 10 50981612 missense probably benign 0.13
R4645:Sim1 UTSW 10 50983997 missense probably benign 0.13
R4781:Sim1 UTSW 10 50983785 missense probably benign 0.08
R4889:Sim1 UTSW 10 50981324 missense probably benign 0.05
R4924:Sim1 UTSW 10 50909902 missense probably damaging 1.00
R6625:Sim1 UTSW 10 50983986 missense probably benign
R6783:Sim1 UTSW 10 50908727 missense possibly damaging 0.72
R6876:Sim1 UTSW 10 50983695 missense possibly damaging 0.77
R6909:Sim1 UTSW 10 50909410 missense possibly damaging 0.92
R6924:Sim1 UTSW 10 50908539 missense probably benign 0.10
R7016:Sim1 UTSW 10 50984250 missense probably benign 0.03
R7135:Sim1 UTSW 10 50895927 missense probably damaging 0.99
R7149:Sim1 UTSW 10 50909540 missense probably damaging 1.00
R7750:Sim1 UTSW 10 50896035 missense possibly damaging 0.94
Z1177:Sim1 UTSW 10 50984328 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AAAGCTTTTGTGGCCAAGTG -3'
(R):5'- CCCGCAAAATGGGCTAGTAAG -3'

Sequencing Primer
(F):5'- GTGGAATTTTACTGTGTTTCAACTCC -3'
(R):5'- GTAAGATCAAGGGACAGCTCTCTCTC -3'
Posted On2019-06-26