Incidental Mutation 'R7337:Tmprss15'
ID569617
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7337 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79071276 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 215 (T215A)
Ref Sequence ENSEMBL: ENSMUSP00000023566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
Predicted Effect probably benign
Transcript: ENSMUST00000023566
AA Change: T215A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: T215A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060402
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A G 14: 49,234,491 M163T possibly damaging Het
Abcb11 A T 2: 69,245,769 H1198Q probably damaging Het
Adamts14 A G 10: 61,207,460 V743A probably damaging Het
Adgrg6 A G 10: 14,467,351 V284A possibly damaging Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Alb A G 5: 90,474,593 K560R probably damaging Het
Aqp9 A T 9: 71,162,482 F8L probably benign Het
Arhgef7 T C 8: 11,785,789 L182P probably damaging Het
Atr A G 9: 95,871,448 D701G probably damaging Het
Calr3 C T 8: 72,431,495 D187N probably damaging Het
Ccdc65 A G 15: 98,721,096 T319A probably benign Het
Ccdc66 A T 14: 27,500,333 L151H probably damaging Het
Ces2e T A 8: 104,931,056 probably null Het
Cfap46 A G 7: 139,630,576 probably null Het
Cfap74 A G 4: 155,460,015 T1034A unknown Het
Cldnd1 T G 16: 58,728,959 probably null Het
Clec4f C A 6: 83,653,208 V123L probably benign Het
Cntn6 C T 6: 104,650,530 T108I probably damaging Het
Crygn T G 5: 24,756,149 D53A possibly damaging Het
Cyp27a1 T A 1: 74,735,435 V204E probably damaging Het
Cyp2c67 A T 19: 39,609,264 probably null Het
Ddb1 T C 19: 10,627,831 V1061A possibly damaging Het
Dnah12 G T 14: 26,766,577 probably null Het
Draxin T C 4: 148,112,759 T194A probably benign Het
Drosha T A 15: 12,846,199 D473E possibly damaging Het
G6pd2 T A 5: 61,810,219 C446S probably benign Het
Gm29106 C T 1: 118,176,912 S3L unknown Het
Grin3a T C 4: 49,702,762 Y908C probably damaging Het
Ints2 G A 11: 86,217,842 A893V probably benign Het
Ippk C T 13: 49,449,291 T371I probably benign Het
Irf2 T A 8: 46,807,281 C83S probably damaging Het
Jph3 C T 8: 121,753,702 A373V probably benign Het
Kcnj6 C T 16: 94,833,214 V13I probably benign Het
Lama3 T C 18: 12,507,040 probably null Het
Lmo7 A T 14: 101,884,204 Q235L probably damaging Het
March7 A G 2: 60,240,845 probably null Het
Mfsd6l A T 11: 68,557,283 Y320F possibly damaging Het
Mroh1 T A 15: 76,451,476 W1440R probably benign Het
Mrps17 G A 5: 129,716,799 G19D probably damaging Het
Myt1 A G 2: 181,802,963 H566R possibly damaging Het
Nav2 T C 7: 49,551,773 L176P possibly damaging Het
Nop58 T A 1: 59,698,440 C139S probably benign Het
Nsd1 A G 13: 55,246,209 D644G probably damaging Het
Nsd2 T A 5: 33,885,472 C1027S probably damaging Het
Nsmce2 A G 15: 59,601,416 I235V probably damaging Het
Nyap2 T C 1: 81,336,515 V642A possibly damaging Het
Olfr300-ps1 A T 7: 86,443,120 L46F unknown Het
Olfr919 A G 9: 38,697,865 V167A probably benign Het
Paqr7 A G 4: 134,507,120 D96G probably benign Het
Parp4 A G 14: 56,602,395 Y520C probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Piezo1 A T 8: 122,485,724 Y1955N Het
Pnmal1 A G 7: 16,961,390 K390R probably benign Het
Prdm10 G T 9: 31,316,241 Q47H probably damaging Het
Psg22 T A 7: 18,719,574 F104I probably benign Het
Ptprf T C 4: 118,211,125 E1738G probably damaging Het
Rad21l A T 2: 151,658,445 L218Q probably damaging Het
Rad54l2 A G 9: 106,705,825 I798T probably damaging Het
Rgs5 G T 1: 169,655,580 M1I probably null Het
Rhbdl2 T C 4: 123,817,866 V132A possibly damaging Het
Rmi1 T A 13: 58,409,579 Y547* probably null Het
Rptn A T 3: 93,396,905 D515V probably benign Het
Rsph10b A G 5: 143,961,215 N505D probably benign Het
Samhd1 T C 2: 157,106,244 D539G probably damaging Het
Scube3 A T 17: 28,168,182 I885F probably damaging Het
Sfmbt1 A G 14: 30,784,739 I247V possibly damaging Het
Slc25a21 T C 12: 56,858,043 I62V probably benign Het
Slc4a11 T A 2: 130,685,532 N648Y probably damaging Het
Slc7a11 A G 3: 50,442,999 V88A possibly damaging Het
Slc7a8 A C 14: 54,726,806 F397V possibly damaging Het
Sox12 A C 2: 152,397,457 L81R probably damaging Het
Spg11 T C 2: 122,084,993 I1057V probably benign Het
St8sia3 G A 18: 64,269,916 V265I probably benign Het
Stxbp5 A G 10: 9,809,130 S509P possibly damaging Het
Svep1 T C 4: 58,108,323 Y1129C probably damaging Het
Tenm4 G T 7: 96,874,126 R1625L probably benign Het
Tlr4 T C 4: 66,839,954 F328S possibly damaging Het
Tmprss9 A T 10: 80,882,670 I62L probably benign Het
Trpm5 C T 7: 143,089,019 A64T probably benign Het
Txk A C 5: 72,731,766 Y148* probably null Het
Uba5 C T 9: 104,055,255 G170R possibly damaging Het
Uggt2 A T 14: 119,086,175 D231E probably benign Het
Ulk4 A T 9: 121,248,927 D525E probably benign Het
Vmn1r158 T A 7: 22,790,224 T187S probably benign Het
Vmn1r52 T A 6: 90,179,623 M303K probably benign Het
Vmn2r54 A G 7: 12,622,117 F454S probably benign Het
Zbp1 A T 2: 173,218,753 L8* probably null Het
Zmym2 A T 14: 56,944,100 D924V probably benign Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 intron probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTTGCATAATTTTGGCAATCAG -3'
(R):5'- TCACACTGCAGCAATGACTTAC -3'

Sequencing Primer
(F):5'- GCAATCAGTATAATGCTATAAAGGGG -3'
(R):5'- AAATCAACTTTGTTTTCTTCCAGC -3'
Posted On2019-09-13