Incidental Mutation 'R7278:Trp53'
ID571567
Institutional Source Beutler Lab
Gene Symbol Trp53
Ensembl Gene ENSMUSG00000059552
Gene Nametransformation related protein 53
Synonymsp44, p53
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7278 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69580359-69591873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69591255 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 365 (L365F)
Ref Sequence ENSEMBL: ENSMUSP00000127130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005371] [ENSMUST00000108657] [ENSMUST00000108658] [ENSMUST00000171247]
Predicted Effect probably benign
Transcript: ENSMUST00000005371
SMART Domains Protein: ENSMUSP00000005371
Gene: ENSMUSG00000059552

DomainStartEndE-ValueType
Pfam:P53_TAD 5 28 1.3e-10 PFAM
low complexity region 69 86 N/A INTRINSIC
Pfam:P53 89 283 8.2e-108 PFAM
Pfam:P53_tetramer 312 353 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108657
AA Change: L362F

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104297
Gene: ENSMUSG00000059552
AA Change: L362F

DomainStartEndE-ValueType
Pfam:P53_TAD 5 28 6.1e-11 PFAM
low complexity region 69 86 N/A INTRINSIC
Pfam:P53 89 283 4.7e-108 PFAM
Pfam:P53_tetramer 312 353 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108658
SMART Domains Protein: ENSMUSP00000104298
Gene: ENSMUSG00000059552

DomainStartEndE-ValueType
Pfam:P53_TAD 8 31 1.4e-12 PFAM
low complexity region 72 89 N/A INTRINSIC
Pfam:P53 92 286 9.8e-113 PFAM
Pfam:P53_tetramer 316 355 5.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171247
AA Change: L365F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127130
Gene: ENSMUSG00000059552
AA Change: L365F

DomainStartEndE-ValueType
Pfam:P53_TAD 8 31 1.2e-10 PFAM
low complexity region 72 89 N/A INTRINSIC
Pfam:P53 92 286 7.9e-108 PFAM
Pfam:P53_tetramer 315 356 4.3e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes tumor protein p53, which responds to diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 is a DNA-binding protein containing transcription activation, DNA-binding, and oligomerization domains. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mice deficient for this gene are developmentally normal but are susceptible to spontaneous tumors. Evidence to date shows that this gene contains one promoter, in contrast to alternative promoters of the human gene, and transcribes a few of splice variants which encode different isoforms, although the biological validity or the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this locus affect cell-cycle regulation and apoptosis. Null homozygotes show high, early-onset tumor incidence; some have persistent hyaloid vasculature and cataracts. Truncated or temperature-sensitive alleles cause early aging phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,476 L142P probably benign Het
Abca13 A T 11: 9,291,126 R996S possibly damaging Het
Abcb6 A G 1: 75,174,373 F558L possibly damaging Het
Acp7 T A 7: 28,630,882 D2V unknown Het
Acvr1c T C 2: 58,284,936 D280G probably damaging Het
Atp8a1 A G 5: 67,624,037 S1124P Het
B4galnt1 A T 10: 127,167,788 T207S probably benign Het
C2cd4d C A 3: 94,364,138 T237N probably benign Het
C8b T C 4: 104,780,627 C99R probably damaging Het
Ccnk C A 12: 108,193,705 Q149K possibly damaging Het
Chfr A G 5: 110,140,360 D47G probably benign Het
Chid1 A T 7: 141,529,488 probably null Het
Cmya5 T A 13: 93,095,700 E960V probably damaging Het
Col18a1 A G 10: 77,096,284 S112P unknown Het
Cps1 G A 1: 67,170,921 V637I probably damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp2c54 A T 19: 40,070,253 L245* probably null Het
Ddr2 G T 1: 169,984,961 T654K probably damaging Het
Dnah10 T C 5: 124,791,791 probably null Het
Elavl4 C T 4: 110,211,425 probably null Het
Emilin1 T C 5: 30,920,660 V921A probably benign Het
Evpl T A 11: 116,223,113 E1250D probably damaging Het
Fam228a C T 12: 4,732,790 G101E probably benign Het
Fam92b T A 8: 120,168,603 T187S possibly damaging Het
Gemin4 T C 11: 76,212,106 T610A probably damaging Het
Glis1 T C 4: 107,435,683 M1T probably null Het
Gm14399 C T 2: 175,130,459 probably benign Het
Gorasp2 C T 2: 70,679,505 T170I probably damaging Het
Gpr37 A G 6: 25,669,342 V501A possibly damaging Het
Grik4 T A 9: 42,622,060 Q388L probably benign Het
Hspg2 T A 4: 137,551,125 D3035E probably damaging Het
Htr4 A T 18: 62,412,176 N11Y probably benign Het
Itgb2l A G 16: 96,429,043 S356P probably damaging Het
Klk1b22 A G 7: 44,114,749 N34D probably benign Het
Lmcd1 A G 6: 112,310,539 D62G possibly damaging Het
Lrp2 C T 2: 69,486,352 G2095E probably damaging Het
Macf1 T A 4: 123,440,743 E4407V possibly damaging Het
Mcm5 T C 8: 75,124,859 F631L probably benign Het
Mov10l1 A G 15: 88,993,868 S170G probably benign Het
Muc5b A T 7: 141,857,502 D1395V unknown Het
Muc6 G A 7: 141,640,575 T1395M probably benign Het
Myh15 A G 16: 49,091,105 D300G probably damaging Het
Nat6 T C 9: 107,583,299 L131P probably damaging Het
Ndst4 A G 3: 125,438,303 T174A probably benign Het
Nek5 T A 8: 22,090,484 N406I probably benign Het
Nr2c2 G A 6: 92,159,378 V400I probably damaging Het
Olfr364-ps1 G T 2: 37,147,009 V266L probably benign Het
Olfr365 T C 2: 37,202,080 Y280H probably damaging Het
Olfr449 G A 6: 42,834,396 probably null Het
Olfr554 T C 7: 102,640,983 S246P probably damaging Het
Olfr612 A T 7: 103,538,728 Y169N probably benign Het
Olfr787 T A 10: 129,462,751 I25N probably damaging Het
Parn T C 16: 13,626,063 probably null Het
Pfkl T C 10: 77,992,023 T468A probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plce1 T C 19: 38,779,896 I2205T possibly damaging Het
Prss16 A T 13: 22,003,147 N442K probably damaging Het
Pus7 A G 5: 23,752,344 S370P probably damaging Het
Ripk3 G T 14: 55,787,284 Y210* probably null Het
Rps6ka2 C A 17: 7,271,635 F317L probably damaging Het
Slc13a3 G A 2: 165,445,528 R169W possibly damaging Het
Slc6a21 T A 7: 45,282,480 I256N possibly damaging Het
Slc6a9 G A 4: 117,868,106 R589Q probably benign Het
Slc8a2 T C 7: 16,141,152 S442P probably damaging Het
Snupn T A 9: 56,982,744 M283K probably damaging Het
Steap3 A T 1: 120,234,357 M395K probably damaging Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Tlr1 A G 5: 64,926,772 V154A probably benign Het
Tmem131 A G 1: 36,796,301 S1580P probably damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Trav14d-3-dv8 G A 14: 53,078,761 R26H probably benign Het
Trp53bp1 A T 2: 121,199,035 I1838N probably damaging Het
Ugt1a5 A T 1: 88,166,886 K279* probably null Het
Unc80 A G 1: 66,552,209 E1141G possibly damaging Het
Vti1b T C 12: 79,166,379 D49G probably benign Het
Wnt10a A T 1: 74,793,482 H78L possibly damaging Het
Zfp869 G A 8: 69,706,478 H482Y probably damaging Het
Zfyve1 A G 12: 83,551,540 V638A probably damaging Het
Other mutations in Trp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Trp53 APN 11 69588523 missense probably damaging 1.00
IGL02105:Trp53 APN 11 69588503 missense probably damaging 1.00
R0112:Trp53 UTSW 11 69588679 missense probably damaging 1.00
R0196:Trp53 UTSW 11 69588680 missense probably damaging 1.00
R0512:Trp53 UTSW 11 69588683 missense probably damaging 1.00
R1976:Trp53 UTSW 11 69588497 missense probably damaging 1.00
R2070:Trp53 UTSW 11 69589632 missense probably damaging 1.00
R2071:Trp53 UTSW 11 69589632 missense probably damaging 1.00
R2988:Trp53 UTSW 11 69588506 missense probably damaging 1.00
R4698:Trp53 UTSW 11 69588422 nonsense probably null
R4776:Trp53 UTSW 11 69586921 missense probably benign 0.05
R4838:Trp53 UTSW 11 69587630 missense probably damaging 1.00
R5269:Trp53 UTSW 11 69589205 missense probably damaging 1.00
R5360:Trp53 UTSW 11 69588740 critical splice donor site probably null
R5399:Trp53 UTSW 11 69588546 missense probably benign 0.19
R5420:Trp53 UTSW 11 69588320 intron probably benign
R5982:Trp53 UTSW 11 69587418 missense probably benign 0.06
R6051:Trp53 UTSW 11 69589608 missense possibly damaging 0.93
R6305:Trp53 UTSW 11 69588707 missense probably damaging 1.00
R6457:Trp53 UTSW 11 69589614 missense probably damaging 1.00
R6947:Trp53 UTSW 11 69588481 missense possibly damaging 0.93
R7339:Trp53 UTSW 11 69589189 missense probably damaging 1.00
R7418:Trp53 UTSW 11 69588388 missense probably damaging 1.00
R7899:Trp53 UTSW 11 69590693 missense probably damaging 1.00
R7982:Trp53 UTSW 11 69590693 missense probably damaging 1.00
Z1176:Trp53 UTSW 11 69589202 missense probably damaging 1.00
Z1176:Trp53 UTSW 11 69589250 missense probably null 0.94
Z1177:Trp53 UTSW 11 69588362 critical splice acceptor site probably null
Z1177:Trp53 UTSW 11 69589211 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTACGAGAACTGACTTCTTGAC -3'
(R):5'- AGTCAGGCCCCACTTTCTTG -3'

Sequencing Primer
(F):5'- ATAGCAAGACCCTGTCTCATGGTG -3'
(R):5'- GGCCCCACTTTCTTGACCATTG -3'
Posted On2019-09-13