Incidental Mutation 'R7278:Trp53'

• ID: 571567
• Institutional Source: Beutler Lab
• Gene Symbol: Trp53
• Ensembl Gene: ENSMUSG00000059552
• Gene Name: transformation related protein 53
• Synonyms: p44, p53
• MMRRC Submission: 045360-MU
• Essential gene?: Non essential (E-score: 0.000)
• Stock #: R7278 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 11
• Chromosomal Location: 69580359-69591873 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): C to T at 69591255 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Leucine to Phenylalanine at position 365 (L365F)
• Ref Sequence: ENSEMBL: ENSMUSP00000127130
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000005371] [ENSMUST00000108657] [ENSMUST00000108658] [ENSMUST00000171247]
• AlphaFold: P02340
• Predicted Effect: probably benign; Transcript: ENSMUST00000005371
• SMART Domains: Protein: ENSMUSP00000005371; Gene: ENSMUSG00000059552

Domain	Start	End	E-Value	Type
Pfam:P53_TAD	5	28	1.3e-10	PFAM
low complexity region	69	86	N/A	INTRINSIC
Pfam:P53	89	283	8.2e-108	PFAM
Pfam:P53_tetramer	312	353	4.4e-21	PFAM

• Predicted Effect: probably benign; Transcript: ENSMUST00000108657; AA Change: L362F; PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
• SMART Domains: Protein: ENSMUSP00000104297; Gene: ENSMUSG00000059552; AA Change: L362F

Domain	Start	End	E-Value	Type
Pfam:P53_TAD	5	28	6.1e-11	PFAM
low complexity region	69	86	N/A	INTRINSIC
Pfam:P53	89	283	4.7e-108	PFAM
Pfam:P53_tetramer	312	353	1.9e-21	PFAM

• Predicted Effect: probably benign; Transcript: ENSMUST00000108658
• SMART Domains: Protein: ENSMUSP00000104298; Gene: ENSMUSG00000059552

Domain	Start	End	E-Value	Type
Pfam:P53_TAD	8	31	1.4e-12	PFAM
low complexity region	72	89	N/A	INTRINSIC
Pfam:P53	92	286	9.8e-113	PFAM
Pfam:P53_tetramer	316	355	5.8e-20	PFAM

• Predicted Effect: probably benign; Transcript: ENSMUST00000171247; AA Change: L365F; PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
• SMART Domains: Protein: ENSMUSP00000127130; Gene: ENSMUSG00000059552; AA Change: L365F

Domain	Start	End	E-Value	Type
Pfam:P53_TAD	8	31	1.2e-10	PFAM
low complexity region	72	89	N/A	INTRINSIC
Pfam:P53	92	286	7.9e-108	PFAM
Pfam:P53_tetramer	315	356	4.3e-21	PFAM

• Meta Mutation Damage Score: 0.0898
• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
• Validation Efficiency: 99% (78/79)
• MGI Phenotype: FUNCTION: This gene encodes tumor protein p53, which responds to diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 is a DNA-binding protein containing transcription activation, DNA-binding, and oligomerization domains. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mice deficient for this gene are developmentally normal but are susceptible to spontaneous tumors. Evidence to date shows that this gene contains one promoter, in contrast to alternative promoters of the human gene, and transcribes a few of splice variants which encode different isoforms, although the biological validity or the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mutations in this locus affect cell-cycle regulation and apoptosis. Null homozygotes show high, early-onset tumor incidence; some have persistent hyaloid vasculature and cataracts. Truncated or temperature-sensitive alleles cause early aging phenotypes. [provided by MGI curators]
• Posted On: 2019-09-13

Predicted Primers

PCR Primer
(F):5'- CCTACGAGAACTGACTTCTTGAC -3'
(R):5'- AGTCAGGCCCCACTTTCTTG -3'

Sequencing Primer
(F):5'- ATAGCAAGACCCTGTCTCATGGTG -3'
(R):5'- GGCCCCACTTTCTTGACCATTG -3'