Incidental Mutation 'R7296:Megf10'
ID571667
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Namemultiple EGF-like-domains 10
Synonyms3000002B06Rik, LOC240312
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R7296 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location57133090-57297467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57275753 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 589 (N589I)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
Predicted Effect probably damaging
Transcript: ENSMUST00000075770
AA Change: N589I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: N589I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139892
AA Change: N589I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: N589I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,143 M226K probably benign Het
2010300C02Rik T C 1: 37,614,618 T1036A possibly damaging Het
4921524L21Rik T G 18: 6,626,385 S132R probably damaging Het
A4gnt T G 9: 99,620,282 I165S probably damaging Het
Abca14 G A 7: 120,278,311 D1061N probably benign Het
Abcc9 G A 6: 142,671,593 P582S probably damaging Het
Abhd5 G A 9: 122,379,573 V343I probably benign Het
Adam6a C T 12: 113,545,572 R522C probably damaging Het
Ankle2 G A 5: 110,237,724 R313H probably damaging Het
Aplf G A 6: 87,646,215 T315I probably damaging Het
Arntl2 G A 6: 146,822,134 V321I not run Het
Asic5 C T 3: 82,021,076 P491S probably benign Het
Atp5b T C 10: 128,085,522 Y230H probably benign Het
B4galt6 A T 18: 20,728,042 I51N probably damaging Het
C4b A G 17: 34,743,659 L23S probably damaging Het
C77080 A G 4: 129,225,418 Y170H probably damaging Het
Cables2 A G 2: 180,260,336 V410A Het
Cdyl A G 13: 35,863,395 M489V probably damaging Het
Clip4 T C 17: 71,790,001 M40T probably damaging Het
Col12a1 T C 9: 79,682,066 Y1069C probably damaging Het
Col6a3 T C 1: 90,827,986 M194V probably benign Het
Colec11 T A 12: 28,594,715 D260V probably damaging Het
Cux2 T C 5: 121,861,256 D1207G probably benign Het
Cyp2d34 G T 15: 82,617,235 N297K possibly damaging Het
Dmbt1 A G 7: 131,112,132 Y1643C unknown Het
Dnmt3c A G 2: 153,715,026 T288A probably benign Het
Dock8 T A 19: 25,184,881 F1842I probably benign Het
Dysf A G 6: 84,106,898 I740V probably benign Het
Epha6 T A 16: 59,915,838 M778L probably benign Het
Eri2 A T 7: 119,786,516 L254* probably null Het
Fam129b T C 2: 32,922,642 S468P possibly damaging Het
Fam43b A G 4: 138,395,841 F56S probably damaging Het
Fat4 C A 3: 38,889,145 S729* probably null Het
Fbxw22 C A 9: 109,382,075 W386L probably benign Het
Fgd6 T A 10: 94,044,047 C254* probably null Het
Fgd6 C A 10: 94,139,881 T1386K probably benign Het
Fkbp7 G T 2: 76,671,764 D98E possibly damaging Het
Gm8251 T A 1: 44,060,916 K341* probably null Het
Hectd1 C T 12: 51,785,852 C913Y possibly damaging Het
Hgf T A 5: 16,564,843 M105K probably benign Het
Icam1 A C 9: 21,019,015 D55A probably benign Het
Itga2 A C 13: 114,857,394 probably null Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Klra17 T A 6: 129,831,592 N226I possibly damaging Het
Krt1 T A 15: 101,850,629 R33S unknown Het
L3mbtl3 T A 10: 26,282,830 D615V unknown Het
Lrp2 T A 2: 69,482,381 Y2521F probably benign Het
Metap1d G C 2: 71,506,785 G14A probably benign Het
Mfap5 T A 6: 122,528,422 D162E probably benign Het
Mixl1 T C 1: 180,696,958 I19V probably benign Het
Mtrr G T 13: 68,568,860 Y411* probably null Het
Myh7 T C 14: 54,990,025 T318A probably benign Het
Nbeal1 T A 1: 60,310,224 Y2348* probably null Het
Nlrc3 T C 16: 3,963,590 S668G probably damaging Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1129 T A 2: 87,575,708 V208E probably damaging Het
Olfr1222 C A 2: 89,124,836 R298S probably benign Het
Olfr527 A T 7: 140,336,741 D293V possibly damaging Het
Pcna A G 2: 132,252,877 S54P probably benign Het
Pde6a A G 18: 61,258,293 T570A probably damaging Het
Phf21b A T 15: 84,855,717 M1K probably null Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prob1 A G 18: 35,653,299 F634S possibly damaging Het
Prss50 A G 9: 110,861,289 T167A probably damaging Het
Ptpn1 T C 2: 167,974,772 V249A probably damaging Het
Rai1 G A 11: 60,188,673 V1188I probably benign Het
Ric1 G A 19: 29,584,578 probably null Het
Robo1 C T 16: 72,989,631 Q844* probably null Het
Rpn1 A G 6: 88,084,637 D36G possibly damaging Het
Serpinb1b A T 13: 33,093,827 M348L probably benign Het
Setd4 T C 16: 93,583,942 probably null Het
Setd5 T G 6: 113,147,557 S1124A probably benign Het
Slc35c1 C A 2: 92,458,739 V154F probably damaging Het
Slc7a6os G T 8: 106,210,489 S113* probably null Het
Syne2 T A 12: 76,103,036 D1787E probably benign Het
Tas2r144 A C 6: 42,215,439 I38L probably damaging Het
Tepsin G T 11: 120,091,708 T512K possibly damaging Het
Utp20 A G 10: 88,770,724 V1662A probably benign Het
Vmn1r201 C T 13: 22,475,339 A241V possibly damaging Het
Vmn2r60 T A 7: 42,136,402 S210T probably benign Het
Wdr6 G T 9: 108,574,585 H700N probably damaging Het
Zdhhc8 T C 16: 18,234,926 T29A probably benign Het
Zfp335 A G 2: 164,900,132 I614T probably damaging Het
Zfp54 T A 17: 21,433,582 S113T probably benign Het
Zfp873 T A 10: 82,061,237 C601S probably damaging Het
Zfyve26 T C 12: 79,278,372 probably null Het
Zmynd8 T C 2: 165,840,009 T201A probably damaging Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57240628 missense probably damaging 1.00
IGL00736:Megf10 APN 18 57292710 missense probably benign 0.35
IGL01631:Megf10 APN 18 57259797 missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57292632 missense probably damaging 1.00
IGL02747:Megf10 APN 18 57290493 missense probably benign 0.43
IGL03298:Megf10 APN 18 57283838 nonsense probably null
megalodon UTSW 18 57287976 nonsense probably null
sharkie UTSW 18 57191185 nonsense probably null
IGL03046:Megf10 UTSW 18 57287983 missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57277688 missense probably damaging 1.00
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57259802 missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57252982 missense probably benign 0.34
R0602:Megf10 UTSW 18 57262100 missense probably damaging 0.98
R0630:Megf10 UTSW 18 57287995 missense probably benign 0.14
R0652:Megf10 UTSW 18 57277724 missense probably benign 0.00
R0658:Megf10 UTSW 18 57252896 missense probably benign 0.00
R0761:Megf10 UTSW 18 57287976 nonsense probably null
R1013:Megf10 UTSW 18 57261219 missense probably benign 0.00
R1130:Megf10 UTSW 18 57262006 missense probably benign 0.06
R1451:Megf10 UTSW 18 57252859 missense probably damaging 0.97
R1699:Megf10 UTSW 18 57277730 splice site probably null
R1729:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1784:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1870:Megf10 UTSW 18 57191185 nonsense probably null
R1961:Megf10 UTSW 18 57212354 missense probably damaging 0.97
R2094:Megf10 UTSW 18 57281713 nonsense probably null
R2213:Megf10 UTSW 18 57288009 nonsense probably null
R2853:Megf10 UTSW 18 57293931 missense probably damaging 1.00
R3772:Megf10 UTSW 18 57283862 missense probably benign 0.39
R3774:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3775:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3776:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3858:Megf10 UTSW 18 57275835 splice site probably benign
R3911:Megf10 UTSW 18 57289393 missense probably damaging 0.99
R3966:Megf10 UTSW 18 57180574 missense probably damaging 1.00
R4043:Megf10 UTSW 18 57259798 missense probably damaging 0.98
R4131:Megf10 UTSW 18 57180535 missense probably damaging 1.00
R4598:Megf10 UTSW 18 57189603 critical splice donor site probably null
R4598:Megf10 UTSW 18 57287812 missense probably damaging 1.00
R4726:Megf10 UTSW 18 57287792 missense probably benign 0.32
R4765:Megf10 UTSW 18 57287794 missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57293858 missense probably benign 0.00
R4928:Megf10 UTSW 18 57240673 missense probably benign
R5412:Megf10 UTSW 18 57191147 missense probably damaging 0.99
R5901:Megf10 UTSW 18 57277108 missense probably benign 0.11
R6015:Megf10 UTSW 18 57253028 missense probably benign 0.01
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6041:Megf10 UTSW 18 57180549 missense probably benign
R6369:Megf10 UTSW 18 57261187 missense probably benign 0.06
R6479:Megf10 UTSW 18 57246570 missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57291807 missense probably benign 0.01
R7228:Megf10 UTSW 18 57189589 missense probably damaging 1.00
R7437:Megf10 UTSW 18 57262131 missense probably damaging 1.00
R7461:Megf10 UTSW 18 57252853 missense probably damaging 0.98
R7488:Megf10 UTSW 18 57191115 missense probably damaging 0.99
R7492:Megf10 UTSW 18 57291794 missense probably benign 0.00
R7542:Megf10 UTSW 18 57189570 missense probably benign 0.07
R7636:Megf10 UTSW 18 57276989 missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57293999 unclassified probably benign
R7650:Megf10 UTSW 18 57293999 unclassified probably benign
R7713:Megf10 UTSW 18 57293999 unclassified probably benign
R7714:Megf10 UTSW 18 57293999 unclassified probably benign
R7716:Megf10 UTSW 18 57293999 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTGGTGCCATCTCTACTG -3'
(R):5'- CTGCCTCAAAATGTCACTAGGAAC -3'

Sequencing Primer
(F):5'- GGTGCCATCTCTACTGCTTATTG -3'
(R):5'- CTCAAAATGTCACTAGGAACTAAGG -3'
Posted On2019-09-13