Incidental Mutation 'R7372:Evc2'
ID572148
Institutional Source Beutler Lab
Gene Symbol Evc2
Ensembl Gene ENSMUSG00000050248
Gene NameEvC ciliary complex subunit 2
SynonymsLbn, limbin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7372 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location37338499-37425055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37387133 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 742 (V742E)
Ref Sequence ENSEMBL: ENSMUSP00000055130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056365]
Predicted Effect probably damaging
Transcript: ENSMUST00000056365
AA Change: V742E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055130
Gene: ENSMUSG00000050248
AA Change: V742E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
Pfam:EVC2_like 147 570 2.1e-191 PFAM
low complexity region 576 600 N/A INTRINSIC
coiled coil region 617 644 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 922 956 N/A INTRINSIC
low complexity region 1057 1071 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, short limbs and ribs, decreased osteoblast differentiation and abnormal chondrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,622,619 V119M probably damaging Het
Acss2 T C 2: 155,557,180 V454A probably damaging Het
Adam6b T A 12: 113,490,164 D200E probably benign Het
Adarb1 T A 10: 77,295,878 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Atrnl1 T C 19: 57,935,646 V1281A possibly damaging Het
Brdt A G 5: 107,370,294 E761G possibly damaging Het
Bsn A T 9: 108,110,519 I2678N unknown Het
C2cd2 A T 16: 97,875,380 C136S Het
Camk4 A G 18: 33,185,125 D445G probably benign Het
Cckar T C 5: 53,707,282 T26A probably damaging Het
Cd209a T A 8: 3,748,857 probably null Het
Cept1 A G 3: 106,503,740 F379S probably benign Het
Crhr1 A G 11: 104,163,893 probably null Het
Cryzl1 T C 16: 91,712,197 E72G probably benign Het
Ctnnal1 T A 4: 56,826,285 E526V possibly damaging Het
Cyp3a41a T C 5: 145,713,564 I90V possibly damaging Het
Dek T C 13: 47,105,577 E51G unknown Het
Fat4 G A 3: 38,890,209 V1084M probably damaging Het
Fscb G A 12: 64,471,824 T956I unknown Het
Glipr2 T C 4: 43,968,184 L29P probably damaging Het
Gm19402 A T 10: 77,690,427 S111T unknown Het
Gm340 T C 19: 41,585,506 L900P probably damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gnl3 T C 14: 31,016,886 K115E probably benign Het
Gpn1 T A 5: 31,501,121 F147I probably damaging Het
Gsdmd T A 15: 75,865,769 L232H probably benign Het
Helz2 A G 2: 181,238,423 V500A possibly damaging Het
Hemk1 T C 9: 107,337,068 E55G probably benign Het
Hs2st1 A T 3: 144,435,460 probably null Het
Ighv1-63 A G 12: 115,495,866 V37A probably damaging Het
Iqsec3 C A 6: 121,384,032 E956* probably null Het
Kcnh8 T A 17: 52,894,101 I521K probably damaging Het
Kif3c T A 12: 3,387,592 M531K probably benign Het
Kif5c T A 2: 49,758,659 probably null Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrrc32 A G 7: 98,499,807 D598G probably benign Het
Mug2 T C 6: 122,083,466 V1387A possibly damaging Het
Nin T A 12: 70,056,029 E275V Het
Olfr493 A G 7: 108,346,496 F162L probably benign Het
Papolg A G 11: 23,866,439 I698T probably benign Het
Pcdhb20 A G 18: 37,506,787 N789D probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pik3cg C T 12: 32,197,197 M842I probably damaging Het
Pnn T A 12: 59,068,979 D135E probably damaging Het
Pold1 C A 7: 44,543,423 R5L possibly damaging Het
Prl8a1 A T 13: 27,574,106 F207I probably damaging Het
Prr11 A G 11: 87,098,774 V257A probably benign Het
Prtg C T 9: 72,851,566 R401* probably null Het
Rasgrp1 A G 2: 117,285,154 M651T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Snx13 A T 12: 35,078,951 I23L probably benign Het
Snx7 A G 3: 117,782,351 L429P probably damaging Het
Spta1 C T 1: 174,197,635 Q689* probably null Het
Spty2d1 T C 7: 46,998,944 D79G probably damaging Het
Tbc1d9b A G 11: 50,168,688 probably null Het
Tnxb T C 17: 34,717,254 F2722L possibly damaging Het
Tppp2 C T 14: 51,919,408 R81C probably benign Het
Trim6 G T 7: 104,232,636 A391S probably benign Het
Trim69 A C 2: 122,178,583 T375P possibly damaging Het
Trim72 A G 7: 128,004,686 N68S possibly damaging Het
Trrap G A 5: 144,789,398 V386I probably benign Het
Ttn T C 2: 76,947,931 I1371V unknown Het
Usp17lb A T 7: 104,841,706 probably null Het
Vmn2r20 A T 6: 123,385,509 L772Q probably damaging Het
Ypel3 A G 7: 126,780,028 E91G probably benign Het
Zbtb21 C T 16: 97,950,369 E905K possibly damaging Het
Zfp189 T A 4: 49,530,417 C507S possibly damaging Het
Other mutations in Evc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Evc2 APN 5 37421891 missense probably benign 0.26
IGL01294:Evc2 APN 5 37347510 critical splice donor site probably null
IGL01547:Evc2 APN 5 37393087 missense probably benign 0.09
IGL02233:Evc2 APN 5 37378337 missense probably damaging 0.99
IGL02253:Evc2 APN 5 37378427 splice site probably benign
IGL02993:Evc2 APN 5 37419157 missense probably benign 0.01
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0324:Evc2 UTSW 5 37393099 missense probably damaging 1.00
R0441:Evc2 UTSW 5 37417467 missense probably damaging 1.00
R0454:Evc2 UTSW 5 37417484 missense possibly damaging 0.78
R1291:Evc2 UTSW 5 37386815 missense probably damaging 1.00
R1433:Evc2 UTSW 5 37393083 missense probably damaging 1.00
R1485:Evc2 UTSW 5 37370556 missense probably benign 0.30
R1491:Evc2 UTSW 5 37393197 critical splice donor site probably null
R1502:Evc2 UTSW 5 37393096 missense probably benign
R1662:Evc2 UTSW 5 37348750 missense probably benign 0.00
R1891:Evc2 UTSW 5 37392079 missense probably damaging 1.00
R1965:Evc2 UTSW 5 37363532 missense possibly damaging 0.73
R1983:Evc2 UTSW 5 37415931 nonsense probably null
R2160:Evc2 UTSW 5 37380518 missense possibly damaging 0.87
R2237:Evc2 UTSW 5 37378183 missense probably benign 0.22
R3926:Evc2 UTSW 5 37383230 missense probably damaging 1.00
R3953:Evc2 UTSW 5 37380587 critical splice donor site probably null
R3959:Evc2 UTSW 5 37415776 missense possibly damaging 0.63
R4281:Evc2 UTSW 5 37338594 missense probably benign 0.33
R4366:Evc2 UTSW 5 37338669 missense possibly damaging 0.93
R4707:Evc2 UTSW 5 37421860 missense probably benign 0.08
R4754:Evc2 UTSW 5 37387031 missense probably damaging 0.99
R5373:Evc2 UTSW 5 37378210 missense probably damaging 1.00
R5593:Evc2 UTSW 5 37386977 missense probably damaging 0.99
R5697:Evc2 UTSW 5 37370608 missense probably damaging 1.00
R5847:Evc2 UTSW 5 37404724 intron probably benign
R5874:Evc2 UTSW 5 37417539 intron probably benign
R6023:Evc2 UTSW 5 37348616 missense probably benign 0.13
R6285:Evc2 UTSW 5 37424579 missense possibly damaging 0.86
R6394:Evc2 UTSW 5 37378275 missense probably damaging 1.00
R6567:Evc2 UTSW 5 37419164 missense probably benign 0.17
R6669:Evc2 UTSW 5 37378378 missense possibly damaging 0.88
R7039:Evc2 UTSW 5 37421888 missense probably damaging 1.00
R7131:Evc2 UTSW 5 37410258 missense probably damaging 1.00
R7144:Evc2 UTSW 5 37386839 missense probably damaging 0.97
R7376:Evc2 UTSW 5 37370639 missense possibly damaging 0.57
R7607:Evc2 UTSW 5 37386856 missense possibly damaging 0.94
R7915:Evc2 UTSW 5 37386862 missense probably damaging 0.98
R8144:Evc2 UTSW 5 37380567 missense probably damaging 1.00
R8506:Evc2 UTSW 5 37383142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGCAGCAGATCTTAGAGG -3'
(R):5'- CAAATCTTATTTGTCTGGGGATGGC -3'

Sequencing Primer
(F):5'- TCTTAGAGGAGCACAGCCG -3'
(R):5'- ATCATATGCTCAGATATCCTGCC -3'
Posted On2019-09-13