Incidental Mutation 'R7144:Evc2'
ID553621
Institutional Source Beutler Lab
Gene Symbol Evc2
Ensembl Gene ENSMUSG00000050248
Gene NameEvC ciliary complex subunit 2
SynonymsLbn, limbin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7144 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location37338499-37425055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37386839 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 644 (D644G)
Ref Sequence ENSEMBL: ENSMUSP00000055130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056365]
Predicted Effect probably damaging
Transcript: ENSMUST00000056365
AA Change: D644G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055130
Gene: ENSMUSG00000050248
AA Change: D644G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
Pfam:EVC2_like 147 570 2.1e-191 PFAM
low complexity region 576 600 N/A INTRINSIC
coiled coil region 617 644 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 922 956 N/A INTRINSIC
low complexity region 1057 1071 N/A INTRINSIC
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in bone formation and skeletal development. Mutations in this gene, as well as in a neighboring gene that lies in a head-to-head configuration, cause Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia that is also known as chondroectodermal dysplasia. Mutations in this gene also cause acrofacial dysostosis Weyers type, also referred to as Curry-Hall syndrome, a disease that combines limb and facial abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, short limbs and ribs, decreased osteoblast differentiation and abnormal chondrocyte physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Adcy10 G T 1: 165,510,370 M184I probably benign Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Ap4e1 T A 2: 127,011,807 I55N probably damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dnah7a A T 1: 53,698,708 probably null Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gemin5 G C 11: 58,141,663 P772A probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gm7298 A T 6: 121,761,587 I376F probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Grin2b T G 6: 135,733,476 D1024A possibly damaging Het
Hmcn1 T C 1: 150,663,873 N2956D probably damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Kiz T G 2: 146,950,510 probably null Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrc49 A T 9: 60,615,156 S381T probably damaging Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Rnf17 G A 14: 56,512,332 probably null Het
Sept11 A G 5: 93,156,866 I181V probably benign Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Slc25a25 A G 2: 32,419,166 F221S probably damaging Het
Spag17 G T 3: 100,027,401 probably null Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St18 A C 1: 6,833,594 E693A probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in Evc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Evc2 APN 5 37421891 missense probably benign 0.26
IGL01294:Evc2 APN 5 37347510 critical splice donor site probably null
IGL01547:Evc2 APN 5 37393087 missense probably benign 0.09
IGL02233:Evc2 APN 5 37378337 missense probably damaging 0.99
IGL02253:Evc2 APN 5 37378427 splice site probably benign
IGL02993:Evc2 APN 5 37419157 missense probably benign 0.01
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0010:Evc2 UTSW 5 37417449 missense probably damaging 1.00
R0324:Evc2 UTSW 5 37393099 missense probably damaging 1.00
R0441:Evc2 UTSW 5 37417467 missense probably damaging 1.00
R0454:Evc2 UTSW 5 37417484 missense possibly damaging 0.78
R1291:Evc2 UTSW 5 37386815 missense probably damaging 1.00
R1433:Evc2 UTSW 5 37393083 missense probably damaging 1.00
R1485:Evc2 UTSW 5 37370556 missense probably benign 0.30
R1491:Evc2 UTSW 5 37393197 critical splice donor site probably null
R1502:Evc2 UTSW 5 37393096 missense probably benign
R1662:Evc2 UTSW 5 37348750 missense probably benign 0.00
R1891:Evc2 UTSW 5 37392079 missense probably damaging 1.00
R1965:Evc2 UTSW 5 37363532 missense possibly damaging 0.73
R1983:Evc2 UTSW 5 37415931 nonsense probably null
R2160:Evc2 UTSW 5 37380518 missense possibly damaging 0.87
R2237:Evc2 UTSW 5 37378183 missense probably benign 0.22
R3926:Evc2 UTSW 5 37383230 missense probably damaging 1.00
R3953:Evc2 UTSW 5 37380587 critical splice donor site probably null
R3959:Evc2 UTSW 5 37415776 missense possibly damaging 0.63
R4281:Evc2 UTSW 5 37338594 missense probably benign 0.33
R4366:Evc2 UTSW 5 37338669 missense possibly damaging 0.93
R4707:Evc2 UTSW 5 37421860 missense probably benign 0.08
R4754:Evc2 UTSW 5 37387031 missense probably damaging 0.99
R5373:Evc2 UTSW 5 37378210 missense probably damaging 1.00
R5593:Evc2 UTSW 5 37386977 missense probably damaging 0.99
R5697:Evc2 UTSW 5 37370608 missense probably damaging 1.00
R5847:Evc2 UTSW 5 37404724 intron probably benign
R5874:Evc2 UTSW 5 37417539 intron probably benign
R6023:Evc2 UTSW 5 37348616 missense probably benign 0.13
R6285:Evc2 UTSW 5 37424579 missense possibly damaging 0.86
R6394:Evc2 UTSW 5 37378275 missense probably damaging 1.00
R6567:Evc2 UTSW 5 37419164 missense probably benign 0.17
R6669:Evc2 UTSW 5 37378378 missense possibly damaging 0.88
R7039:Evc2 UTSW 5 37421888 missense probably damaging 1.00
R7131:Evc2 UTSW 5 37410258 missense probably damaging 1.00
R7372:Evc2 UTSW 5 37387133 missense probably damaging 0.98
R7376:Evc2 UTSW 5 37370639 missense possibly damaging 0.57
R7607:Evc2 UTSW 5 37386856 missense possibly damaging 0.94
R7915:Evc2 UTSW 5 37386862 missense probably damaging 0.98
R8144:Evc2 UTSW 5 37380567 missense probably damaging 1.00
R8506:Evc2 UTSW 5 37383142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTCCTGCTCATTCAATTGC -3'
(R):5'- TCCAGTGCATCCTGCTGTAG -3'

Sequencing Primer
(F):5'- AATTGCCCTTTCTCACATTCCCG -3'
(R):5'- AGCTCCTGGCCACGTTC -3'
Posted On2019-05-15