Mutagenetix > Incidental Mutations

Incidental Mutation 'R7372:Pik3cg'

572173

Institutional Source

Beutler Lab

Gene Symbol

Pik3cg

Ensembl Gene

ENSMUSG00000020573

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma

Synonyms

PI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7372 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32173473-32208659 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32197197 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 842 (M842I)

Ref Sequence

ENSEMBL: ENSMUSP00000062864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]

Predicted Effect

probably damaging
Transcript: ENSMUST00000053215
AA Change: M842I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573
AA Change: M842I

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000085469
AA Change: M842I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573
AA Change: M842I

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000156904
AA Change: M842I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573
AA Change: M842I

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000217915
AA Change: M842I

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably damaging
Transcript: ENSMUST00000220366
AA Change: M842I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.4944

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl2	G	A	1: 156,622,619	V119M	probably damaging	Het
Acss2	T	C	2: 155,557,180	V454A	probably damaging	Het
Adam6b	T	A	12: 113,490,164	D200E	probably benign	Het
Adarb1	T	A	10: 77,295,878		probably null	Het
Aqp12	C	T	1: 93,006,366		probably benign	Het
Atrnl1	T	C	19: 57,935,646	V1281A	possibly damaging	Het
Brdt	A	G	5: 107,370,294	E761G	possibly damaging	Het
Bsn	A	T	9: 108,110,519	I2678N	unknown	Het
C2cd2	A	T	16: 97,875,380	C136S		Het
Camk4	A	G	18: 33,185,125	D445G	probably benign	Het
Cckar	T	C	5: 53,707,282	T26A	probably damaging	Het
Cd209a	T	A	8: 3,748,857		probably null	Het
Cept1	A	G	3: 106,503,740	F379S	probably benign	Het
Crhr1	A	G	11: 104,163,893		probably null	Het
Cryzl1	T	C	16: 91,712,197	E72G	probably benign	Het
Ctnnal1	T	A	4: 56,826,285	E526V	possibly damaging	Het
Cyp3a41a	T	C	5: 145,713,564	I90V	possibly damaging	Het
Dek	T	C	13: 47,105,577	E51G	unknown	Het
Evc2	T	A	5: 37,387,133	V742E	probably damaging	Het
Fat4	G	A	3: 38,890,209	V1084M	probably damaging	Het
Fscb	G	A	12: 64,471,824	T956I	unknown	Het
Glipr2	T	C	4: 43,968,184	L29P	probably damaging	Het
Gm19402	A	T	10: 77,690,427	S111T	unknown	Het
Gm340	T	C	19: 41,585,506	L900P	probably damaging	Het
Gm4553	ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC	ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC	7: 142,165,420		probably benign	Het
Gnl3	T	C	14: 31,016,886	K115E	probably benign	Het
Gpn1	T	A	5: 31,501,121	F147I	probably damaging	Het
Gsdmd	T	A	15: 75,865,769	L232H	probably benign	Het
Helz2	A	G	2: 181,238,423	V500A	possibly damaging	Het
Hemk1	T	C	9: 107,337,068	E55G	probably benign	Het
Hs2st1	A	T	3: 144,435,460		probably null	Het
Ighv1-63	A	G	12: 115,495,866	V37A	probably damaging	Het
Iqsec3	C	A	6: 121,384,032	E956*	probably null	Het
Kcnh8	T	A	17: 52,894,101	I521K	probably damaging	Het
Kif3c	T	A	12: 3,387,592	M531K	probably benign	Het
Kif5c	T	A	2: 49,758,659		probably null	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Lrrc32	A	G	7: 98,499,807	D598G	probably benign	Het
Mug2	T	C	6: 122,083,466	V1387A	possibly damaging	Het
Nin	T	A	12: 70,056,029	E275V		Het
Olfr493	A	G	7: 108,346,496	F162L	probably benign	Het
Papolg	A	G	11: 23,866,439	I698T	probably benign	Het
Pcdhb20	A	G	18: 37,506,787	N789D	probably benign	Het
Pih1d3	A	T	1: 31,223,351	D138V	probably damaging	Het
Pnn	T	A	12: 59,068,979	D135E	probably damaging	Het
Pold1	C	A	7: 44,543,423	R5L	possibly damaging	Het
Prl8a1	A	T	13: 27,574,106	F207I	probably damaging	Het
Prr11	A	G	11: 87,098,774	V257A	probably benign	Het
Prtg	C	T	9: 72,851,566	R401*	probably null	Het
Rasgrp1	A	G	2: 117,285,154	M651T	probably benign	Het
Ryr2	T	A	13: 11,680,999	H2994L	probably damaging	Het
Snx13	A	T	12: 35,078,951	I23L	probably benign	Het
Snx7	A	G	3: 117,782,351	L429P	probably damaging	Het
Spta1	C	T	1: 174,197,635	Q689*	probably null	Het
Spty2d1	T	C	7: 46,998,944	D79G	probably damaging	Het
Tbc1d9b	A	G	11: 50,168,688		probably null	Het
Tnxb	T	C	17: 34,717,254	F2722L	possibly damaging	Het
Tppp2	C	T	14: 51,919,408	R81C	probably benign	Het
Trim6	G	T	7: 104,232,636	A391S	probably benign	Het
Trim69	A	C	2: 122,178,583	T375P	possibly damaging	Het
Trim72	A	G	7: 128,004,686	N68S	possibly damaging	Het
Trrap	G	A	5: 144,789,398	V386I	probably benign	Het
Ttn	T	C	2: 76,947,931	I1371V	unknown	Het
Usp17lb	A	T	7: 104,841,706		probably null	Het
Vmn2r20	A	T	6: 123,385,509	L772Q	probably damaging	Het
Ypel3	A	G	7: 126,780,028	E91G	probably benign	Het
Zbtb21	C	T	16: 97,950,369	E905K	possibly damaging	Het
Zfp189	T	A	4: 49,530,417	C507S	possibly damaging	Het

Other mutations in Pik3cg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pik3cg	APN	12	32205149	missense	probably damaging	1.00
IGL02182:Pik3cg	APN	12	32205273	missense	possibly damaging	0.90
IGL02273:Pik3cg	APN	12	32176810	missense	probably damaging	1.00
IGL02312:Pik3cg	APN	12	32194821	missense	possibly damaging	0.55
IGL02752:Pik3cg	APN	12	32204263	missense	probably damaging	1.00
IGL03107:Pik3cg	APN	12	32200595	missense	probably damaging	1.00
IGL03139:Pik3cg	APN	12	32192223	missense	probably damaging	1.00
IGL03267:Pik3cg	APN	12	32205308	missense	possibly damaging	0.94
IGL03367:Pik3cg	APN	12	32192121	missense	probably benign	0.01
PIT4283001:Pik3cg	UTSW	12	32205865	missense	probably damaging	1.00
PIT4472001:Pik3cg	UTSW	12	32204984	missense	probably damaging	0.99
PIT4514001:Pik3cg	UTSW	12	32204903	missense	probably damaging	1.00
R0112:Pik3cg	UTSW	12	32195715	splice site	probably benign
R0145:Pik3cg	UTSW	12	32204322	missense	probably benign	0.20
R0279:Pik3cg	UTSW	12	32204791	missense	probably damaging	1.00
R0471:Pik3cg	UTSW	12	32194771	missense	probably damaging	0.99
R0494:Pik3cg	UTSW	12	32204546	missense	possibly damaging	0.84
R0573:Pik3cg	UTSW	12	32197197	missense	probably damaging	1.00
R0631:Pik3cg	UTSW	12	32205203	missense	probably benign
R0699:Pik3cg	UTSW	12	32197342	splice site	probably benign
R0826:Pik3cg	UTSW	12	32195673	missense	possibly damaging	0.78
R1076:Pik3cg	UTSW	12	32195714	splice site	probably benign
R1101:Pik3cg	UTSW	12	32195646	missense	probably null	0.98
R1459:Pik3cg	UTSW	12	32204984	missense	probably damaging	0.99
R1625:Pik3cg	UTSW	12	32194742	missense	probably damaging	1.00
R1971:Pik3cg	UTSW	12	32192153	missense	probably damaging	1.00
R1992:Pik3cg	UTSW	12	32204025	missense	possibly damaging	0.83
R2109:Pik3cg	UTSW	12	32193710	missense	possibly damaging	0.75
R2319:Pik3cg	UTSW	12	32176736	missense	probably damaging	0.99
R3421:Pik3cg	UTSW	12	32204739	missense	probably damaging	1.00
R3422:Pik3cg	UTSW	12	32204739	missense	probably damaging	1.00
R3740:Pik3cg	UTSW	12	32205224	missense	probably damaging	1.00
R3777:Pik3cg	UTSW	12	32194709	missense	probably damaging	0.98
R4300:Pik3cg	UTSW	12	32176672	missense	probably damaging	1.00
R4395:Pik3cg	UTSW	12	32204092	missense	probably damaging	1.00
R4725:Pik3cg	UTSW	12	32193597	critical splice donor site	probably null
R4785:Pik3cg	UTSW	12	32205199	missense	probably damaging	0.97
R4809:Pik3cg	UTSW	12	32204081	missense	possibly damaging	0.46
R4981:Pik3cg	UTSW	12	32204104	missense	possibly damaging	0.77
R5033:Pik3cg	UTSW	12	32199196	splice site	probably null
R5161:Pik3cg	UTSW	12	32204978	missense	possibly damaging	0.92
R5806:Pik3cg	UTSW	12	32204953	missense	possibly damaging	0.88
R6136:Pik3cg	UTSW	12	32204359	missense	probably benign	0.00
R6746:Pik3cg	UTSW	12	32194758	missense	probably damaging	1.00
R6895:Pik3cg	UTSW	12	32204347	missense	possibly damaging	0.87
R7000:Pik3cg	UTSW	12	32192129	missense	probably damaging	1.00
R7089:Pik3cg	UTSW	12	32176846	missense	probably benign	0.00
R7113:Pik3cg	UTSW	12	32205667	missense	probably damaging	0.98
R7483:Pik3cg	UTSW	12	32195648	missense	probably damaging	0.99
R7596:Pik3cg	UTSW	12	32204741	missense	probably damaging	1.00
R7771:Pik3cg	UTSW	12	32204014	missense	probably benign
R7910:Pik3cg	UTSW	12	32200517	missense	probably benign	0.16
R7974:Pik3cg	UTSW	12	32204032	missense	probably benign	0.00
R8084:Pik3cg	UTSW	12	32195688	missense	probably benign	0.30
R8352:Pik3cg	UTSW	12	32193640	missense	probably damaging	1.00
R8452:Pik3cg	UTSW	12	32193640	missense	probably damaging	1.00
Z1176:Pik3cg	UTSW	12	32204795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACACATCTTTGAAAGGACAGAGAG -3'
(R):5'- GGCCCCTGTGTTTAGCAATG -3'

Sequencing Primer
(F):5'- GAACTAAGGCGCTAGTAAAACTTATC -3'
(R):5'- GAGAGAATCTGTATCTCCTCCATGTG -3'

Posted On

2019-09-13