Incidental Mutation 'R7410:Cfap44'
ID575041
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7410 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44468413 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1509 (S1509C)
Ref Sequence ENSEMBL: ENSMUSP00000097331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]
Predicted Effect probably damaging
Transcript: ENSMUST00000099742
AA Change: S1509C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: S1509C

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120049
AA Change: S1509C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: S1509C

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210017I01Rik A G 3: 92,605,244 S3P unknown Het
Adgrv1 A T 13: 81,563,619 D1079E probably benign Het
Agbl5 A T 5: 30,890,688 Y102F possibly damaging Het
Ankfy1 T C 11: 72,761,504 L1094S probably damaging Het
Ankrd42 A T 7: 92,610,554 V337E possibly damaging Het
Axl A G 7: 25,758,783 L849P probably benign Het
Bmpr2 T C 1: 59,868,493 I915T probably benign Het
Cables1 T A 18: 11,941,225 F494L probably benign Het
Cacna1e A C 1: 154,472,234 V927G probably benign Het
Cavin1 A T 11: 100,958,844 V320E probably damaging Het
Cemip T G 7: 83,952,834 S916R probably damaging Het
Cep57 G A 9: 13,818,684 probably benign Het
Ces1d T C 8: 93,192,805 N120D probably damaging Het
Chga A G 12: 102,562,607 D281G probably benign Het
Clstn2 A G 9: 97,541,867 F282L probably benign Het
Cnot1 A T 8: 95,733,159 V1855E possibly damaging Het
Cnr1 T A 4: 33,944,119 V169D probably damaging Het
Cpd T A 11: 76,782,308 H1337L probably damaging Het
Crabp2 T A 3: 87,952,278 D78E probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp2ab1 G A 16: 20,316,725 A9V probably benign Het
Cyp3a41b T C 5: 145,578,157 D86G probably damaging Het
Dner T A 1: 84,585,611 D96V probably damaging Het
Duox1 C A 2: 122,346,393 T1465N probably damaging Het
Ehd3 T A 17: 73,805,433 V64E probably benign Het
Ehmt1 A G 2: 24,848,068 V508A probably benign Het
Ephb3 G A 16: 21,221,408 V761I possibly damaging Het
Fam161b T C 12: 84,357,801 Q35R probably benign Het
Fam186a T A 15: 99,946,945 K473* probably null Het
Fam227b A T 2: 126,119,063 D215E probably damaging Het
Fkbp15 C A 4: 62,340,299 D144Y probably damaging Het
Galt T C 4: 41,757,707 I259T possibly damaging Het
Gbp11 G A 5: 105,343,908 P8S probably damaging Het
Gfap A T 11: 102,893,137 M339K probably damaging Het
Gm14443 C T 2: 175,169,276 R459Q possibly damaging Het
Grip1 A G 10: 120,020,020 N632S probably benign Het
Hcar1 T G 5: 123,879,098 I177L possibly damaging Het
Hist1h4n G A 13: 21,832,041 R40W probably damaging Het
Ighv1-37 A G 12: 114,896,479 V37A probably damaging Het
Ilf3 T A 9: 21,399,804 F657L unknown Het
Ints2 T G 11: 86,233,226 T579P probably benign Het
Iqgap1 G T 7: 80,723,030 Y1520* probably null Het
Kdm4a T C 4: 118,143,918 H884R possibly damaging Het
Krtap19-1 A T 16: 88,869,244 Y52N unknown Het
Lama5 A T 2: 180,202,390 probably null Het
Lrrc72 T C 12: 36,222,804 N89D probably damaging Het
Med13l A G 5: 118,560,832 D16G possibly damaging Het
Mefv A G 16: 3,715,681 L242P probably damaging Het
Mob3c T C 4: 115,831,587 Y106H probably damaging Het
Nlrp1a A G 11: 71,123,857 I189T probably damaging Het
Nudt7 T C 8: 114,133,819 probably benign Het
Olfr1303 T A 2: 111,813,926 I267L probably benign Het
Olfr62 T C 4: 118,666,432 L305P probably benign Het
Pappa A G 4: 65,335,719 T1537A probably damaging Het
Pik3r4 T A 9: 105,650,591 V381E probably damaging Het
Pkd1 T A 17: 24,575,881 Y2181N probably damaging Het
Pmel G T 10: 128,716,484 V396F probably benign Het
Prdm9 A G 17: 15,544,997 I507T possibly damaging Het
Psme4 C T 11: 30,815,279 Q549* probably null Het
Ptprg T A 14: 11,962,657 W152R probably damaging Het
Ptprm A C 17: 66,693,566 V1141G probably damaging Het
Rapgef5 G A 12: 117,721,328 V505M probably damaging Het
Rnf213 T A 11: 119,435,051 M1558K Het
Slc35a1 A G 4: 34,675,034 V168A probably benign Het
Srebf1 T C 11: 60,205,867 T347A probably benign Het
Stard9 T A 2: 120,701,497 V2745D probably benign Het
Taar7e A T 10: 24,038,526 T305S probably benign Het
Tie1 T C 4: 118,479,877 S551G probably benign Het
Tmc5 T A 7: 118,623,597 Y173* probably null Het
Tns2 T A 15: 102,110,526 V384D probably damaging Het
Tubgcp4 T A 2: 121,184,409 Y267N probably damaging Het
Vmn1r53 A G 6: 90,223,718 V208A probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdfy4 T C 14: 32,974,234 D2784G Het
Zfp712 A C 13: 67,041,336 S376A probably benign Het
Znrf3 C T 11: 5,288,955 C232Y unknown Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1385:Cfap44 UTSW 16 44470775 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2023:Cfap44 UTSW 16 44416012 missense probably benign 0.01
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2147:Cfap44 UTSW 16 44451684 missense probably benign 0.31
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4178:Cfap44 UTSW 16 44451853 missense possibly damaging 0.81
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5164:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6322:Cfap44 UTSW 16 44433666 nonsense probably null
R6836:Cfap44 UTSW 16 44404079 missense probably damaging 0.99
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
R7233:Cfap44 UTSW 16 44422408 missense probably damaging 0.99
R7294:Cfap44 UTSW 16 44404893 intron probably benign
R7298:Cfap44 UTSW 16 44481412 missense probably benign 0.04
R7332:Cfap44 UTSW 16 44429828 missense probably damaging 1.00
R7456:Cfap44 UTSW 16 44431942 missense probably benign 0.07
R7491:Cfap44 UTSW 16 44470748 missense probably damaging 1.00
R7587:Cfap44 UTSW 16 44404106 missense probably benign 0.02
R7698:Cfap44 UTSW 16 44433786 missense probably damaging 0.99
R7717:Cfap44 UTSW 16 44429935 missense probably damaging 0.97
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCTTGGGGATGATATTCAGACATTTG -3'
(R):5'- GCTTGTAGGCTTTACTTCATGC -3'

Sequencing Primer
(F):5'- CTTGCTATGACTGGATTCAACGAGC -3'
(R):5'- AGGCTTTACTTCATGCATTTAAAAC -3'
Posted On2019-10-07