Mutagenetix > Incidental Mutations

Incidental Mutation 'R7410:Cnot1'

575006

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7410 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 95733159 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1855 (V1855E)

Ref Sequence

ENSEMBL: ENSMUSP00000063565 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068452
AA Change: V1855E

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: V1855E

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098473
AA Change: V1860E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: V1860E

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211887
AA Change: V1853E

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000212415

Predicted Effect

probably benign
Transcript: ENSMUST00000213006

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210017I01Rik	A	G	3: 92,605,244	S3P	unknown	Het
Adgrv1	A	T	13: 81,563,619	D1079E	probably benign	Het
Agbl5	A	T	5: 30,890,688	Y102F	possibly damaging	Het
Ankfy1	T	C	11: 72,761,504	L1094S	probably damaging	Het
Ankrd42	A	T	7: 92,610,554	V337E	possibly damaging	Het
Axl	A	G	7: 25,758,783	L849P	probably benign	Het
Bmpr2	T	C	1: 59,868,493	I915T	probably benign	Het
Cables1	T	A	18: 11,941,225	F494L	probably benign	Het
Cacna1e	A	C	1: 154,472,234	V927G	probably benign	Het
Cavin1	A	T	11: 100,958,844	V320E	probably damaging	Het
Cemip	T	G	7: 83,952,834	S916R	probably damaging	Het
Cep57	G	A	9: 13,818,684		probably benign	Het
Ces1d	T	C	8: 93,192,805	N120D	probably damaging	Het
Cfap44	A	T	16: 44,468,413	S1509C	probably damaging	Het
Chga	A	G	12: 102,562,607	D281G	probably benign	Het
Clstn2	A	G	9: 97,541,867	F282L	probably benign	Het
Cnr1	T	A	4: 33,944,119	V169D	probably damaging	Het
Cpd	T	A	11: 76,782,308	H1337L	probably damaging	Het
Crabp2	T	A	3: 87,952,278	D78E	probably damaging	Het
Crat	C	T	2: 30,404,565	R497Q	probably benign	Het
Cyp2ab1	G	A	16: 20,316,725	A9V	probably benign	Het
Cyp3a41b	T	C	5: 145,578,157	D86G	probably damaging	Het
Dner	T	A	1: 84,585,611	D96V	probably damaging	Het
Duox1	C	A	2: 122,346,393	T1465N	probably damaging	Het
Ehd3	T	A	17: 73,805,433	V64E	probably benign	Het
Ehmt1	A	G	2: 24,848,068	V508A	probably benign	Het
Ephb3	G	A	16: 21,221,408	V761I	possibly damaging	Het
Fam161b	T	C	12: 84,357,801	Q35R	probably benign	Het
Fam186a	T	A	15: 99,946,945	K473*	probably null	Het
Fam227b	A	T	2: 126,119,063	D215E	probably damaging	Het
Fkbp15	C	A	4: 62,340,299	D144Y	probably damaging	Het
Galt	T	C	4: 41,757,707	I259T	possibly damaging	Het
Gbp11	G	A	5: 105,343,908	P8S	probably damaging	Het
Gfap	A	T	11: 102,893,137	M339K	probably damaging	Het
Gm14443	C	T	2: 175,169,276	R459Q	possibly damaging	Het
Grip1	A	G	10: 120,020,020	N632S	probably benign	Het
Hcar1	T	G	5: 123,879,098	I177L	possibly damaging	Het
Hist1h4n	G	A	13: 21,832,041	R40W	probably damaging	Het
Ighv1-37	A	G	12: 114,896,479	V37A	probably damaging	Het
Ilf3	T	A	9: 21,399,804	F657L	unknown	Het
Ints2	T	G	11: 86,233,226	T579P	probably benign	Het
Iqgap1	G	T	7: 80,723,030	Y1520*	probably null	Het
Kdm4a	T	C	4: 118,143,918	H884R	possibly damaging	Het
Krtap19-1	A	T	16: 88,869,244	Y52N	unknown	Het
Lama5	A	T	2: 180,202,390		probably null	Het
Lrrc72	T	C	12: 36,222,804	N89D	probably damaging	Het
Med13l	A	G	5: 118,560,832	D16G	possibly damaging	Het
Mefv	A	G	16: 3,715,681	L242P	probably damaging	Het
Mob3c	T	C	4: 115,831,587	Y106H	probably damaging	Het
Nlrp1a	A	G	11: 71,123,857	I189T	probably damaging	Het
Nudt7	T	C	8: 114,133,819		probably benign	Het
Olfr1303	T	A	2: 111,813,926	I267L	probably benign	Het
Olfr62	T	C	4: 118,666,432	L305P	probably benign	Het
Pappa	A	G	4: 65,335,719	T1537A	probably damaging	Het
Pik3r4	T	A	9: 105,650,591	V381E	probably damaging	Het
Pkd1	T	A	17: 24,575,881	Y2181N	probably damaging	Het
Pmel	G	T	10: 128,716,484	V396F	probably benign	Het
Prdm9	A	G	17: 15,544,997	I507T	possibly damaging	Het
Psme4	C	T	11: 30,815,279	Q549*	probably null	Het
Ptprg	T	A	14: 11,962,657	W152R	probably damaging	Het
Ptprm	A	C	17: 66,693,566	V1141G	probably damaging	Het
Rapgef5	G	A	12: 117,721,328	V505M	probably damaging	Het
Rnf213	T	A	11: 119,435,051	M1558K		Het
Slc35a1	A	G	4: 34,675,034	V168A	probably benign	Het
Srebf1	T	C	11: 60,205,867	T347A	probably benign	Het
Stard9	T	A	2: 120,701,497	V2745D	probably benign	Het
Taar7e	A	T	10: 24,038,526	T305S	probably benign	Het
Tie1	T	C	4: 118,479,877	S551G	probably benign	Het
Tmc5	T	A	7: 118,623,597	Y173*	probably null	Het
Tns2	T	A	15: 102,110,526	V384D	probably damaging	Het
Tubgcp4	T	A	2: 121,184,409	Y267N	probably damaging	Het
Vmn1r53	A	G	6: 90,223,718	V208A	probably damaging	Het
Vwa8	A	C	14: 78,982,234		probably null	Het
Wdfy4	T	C	14: 32,974,234	D2784G		Het
Zfp712	A	C	13: 67,041,336	S376A	probably benign	Het
Znrf3	C	T	11: 5,288,955	C232Y	unknown	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
barge	UTSW	8	95734129	missense	probably benign	0.13
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7940:Cnot1	UTSW	8	95745647	frame shift	probably null
X0050:Cnot1	UTSW	8	95743098	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GAATCAACAGTAGCTGTGATCAAC -3'
(R):5'- TCATACTAGGTTGCCCCAGC -3'

Sequencing Primer
(F):5'- GCATGAGTATGGAGGTAATTCTGACC -3'
(R):5'- ATACTAGGTTGCCCCAGCTGATG -3'

Posted On

2019-10-07