Mutagenetix > Incidental Mutation

Incidental Mutation 'R7587:Cfap44'

587233

Institutional Source

Beutler Lab

Gene Symbol

Cfap44

Ensembl Gene

ENSMUSG00000071550

Gene Name

cilia and flagella associated protein 44

Synonyms

6330444M21Rik, D16Ertd642e, Wdr52

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44394796-44482428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44404106 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 59 (E59G)

Ref Sequence

ENSEMBL: ENSMUSP00000097331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049] [ENSMUST00000147988]

AlphaFold

E9Q5M6

Predicted Effect

probably benign
Transcript: ENSMUST00000099742
AA Change: E59G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: E59G

Domain	Start	End	E-Value	Type
low complexity region	42	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
Blast:WD40	161	201	1e-7	BLAST
WD40	204	246	4.58e1	SMART
WD40	249	288	4.62e-1	SMART
Blast:WD40	292	337	2e-15	BLAST
WD40	342	381	4.8e-2	SMART
WD40	447	486	4.95e-4	SMART
WD40	491	532	2.64e2	SMART
WD40	552	591	2.98e-7	SMART
Blast:WD40	595	634	1e-19	BLAST
coiled coil region	669	711	N/A	INTRINSIC
WD40	780	820	3.82e1	SMART
WD40	830	872	2.4e-2	SMART
coiled coil region	907	955	N/A	INTRINSIC
coiled coil region	1101	1122	N/A	INTRINSIC
low complexity region	1266	1295	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
coiled coil region	1402	1459	N/A	INTRINSIC
low complexity region	1476	1488	N/A	INTRINSIC
low complexity region	1489	1523	N/A	INTRINSIC
coiled coil region	1543	1607	N/A	INTRINSIC
coiled coil region	1630	1731	N/A	INTRINSIC
coiled coil region	1795	1822	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120049
AA Change: E59G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: E59G

Domain	Start	End	E-Value	Type
low complexity region	42	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
Blast:WD40	161	201	1e-7	BLAST
WD40	204	246	4.58e1	SMART
WD40	249	288	4.62e-1	SMART
Blast:WD40	292	337	2e-15	BLAST
WD40	342	381	4.8e-2	SMART
WD40	447	486	4.95e-4	SMART
WD40	491	532	2.64e2	SMART
WD40	552	591	2.98e-7	SMART
Blast:WD40	595	634	1e-19	BLAST
coiled coil region	669	711	N/A	INTRINSIC
WD40	780	820	3.82e1	SMART
WD40	830	872	2.4e-2	SMART
coiled coil region	907	955	N/A	INTRINSIC
coiled coil region	1101	1122	N/A	INTRINSIC
low complexity region	1266	1295	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
coiled coil region	1402	1459	N/A	INTRINSIC
low complexity region	1476	1488	N/A	INTRINSIC
low complexity region	1489	1523	N/A	INTRINSIC
coiled coil region	1543	1607	N/A	INTRINSIC
coiled coil region	1630	1731	N/A	INTRINSIC
coiled coil region	1795	1822	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147988
AA Change: E59G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,792,087	T131A	probably damaging	Het
Asah1	A	T	8: 41,374,541	V15D	probably benign	Het
Asic1	A	C	15: 99,695,590	Q276P	probably damaging	Het
Atl2	A	T	17: 79,865,067	V158E	probably benign	Het
Atrn	T	A	2: 130,980,114	I909N	probably damaging	Het
BC034090	A	G	1: 155,217,486	V742A	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Cdh20	T	C	1: 104,941,279	F165S	probably damaging	Het
Clpsl2	G	A	17: 28,549,541	V10I	probably benign	Het
D630003M21Rik	T	C	2: 158,196,388	Y1046C	probably benign	Het
D630003M21Rik	T	A	2: 158,201,056	S855C	probably damaging	Het
D6Wsu163e	A	G	6: 126,955,896	I361V	probably benign	Het
Dchs2	A	G	3: 83,304,515	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,483,135	K679Q	probably damaging	Het
Dio2	A	G	12: 90,729,560	V218A	probably benign	Het
Fam208b	T	C	13: 3,568,849	K2251E	possibly damaging	Het
Gm3286	A	G	5: 95,521,411	T100A	probably damaging	Het
Gpr107	A	T	2: 31,168,826	K109N	probably benign	Het
Gpr108	C	T	17: 57,236,732	R448Q	probably damaging	Het
Gucy2c	A	G	6: 136,704,290	V932A	probably damaging	Het
Kcnj8	T	C	6: 142,566,339	T181A	probably damaging	Het
Kdm3b	A	G	18: 34,797,027		probably null	Het
Lipc	A	G	9: 70,818,924	Y168H	probably damaging	Het
Lipi	C	T	16: 75,550,215	V439M	probably benign	Het
Lpp	A	T	16: 24,762,279		probably null	Het
Lrp1b	T	G	2: 40,730,717	D3583A		Het
Ltbr	T	C	6: 125,312,352	T165A	probably benign	Het
Mroh3	A	G	1: 136,190,998	I527T	probably benign	Het
Mylk	A	G	16: 34,922,517	E1133G	probably benign	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Ncbp3	T	C	11: 73,066,765		probably null	Het
Nedd1	G	A	10: 92,698,730	T306M	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nox4	A	G	7: 87,317,302	H207R	probably damaging	Het
Nsun6	T	C	2: 15,039,825	Q110R	probably benign	Het
Olfr22-ps1	C	T	11: 73,955,184	Q165*	probably null	Het
Olfr668	C	T	7: 104,925,056	R236H	probably benign	Het
Olfr851	T	A	9: 19,497,522	V258E	probably damaging	Het
Pappa2	T	C	1: 158,851,131	D905G	probably damaging	Het
Pepd	T	C	7: 34,969,540	L195S	probably damaging	Het
Pms1	A	G	1: 53,207,316	S355P	probably benign	Het
Pop1	A	T	15: 34,502,413	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,940	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Rfc3	A	T	5: 151,651,151	M1K	probably null	Het
Rffl	T	C	11: 82,810,148	D284G	probably damaging	Het
Robo3	T	C	9: 37,429,646	D110G	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Slc1a7	T	A	4: 108,010,486	I457K	possibly damaging	Het
Smco1	A	G	16: 32,273,723	M71V	probably benign	Het
Snrnp200	G	A	2: 127,227,902	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,219	I356F	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tbce	C	T	13: 14,019,742	V111M	probably damaging	Het
Tlnrd1	A	G	7: 83,882,947	L92P	probably damaging	Het
Tnr	T	A	1: 159,886,208	D735E	probably benign	Het
Tram1	T	C	1: 13,579,547	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Unc5b	C	T	10: 60,783,120	C81Y	probably damaging	Het
Vps13a	G	A	19: 16,703,789	T1041M	probably benign	Het

Other mutations in Cfap44

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Cfap44	APN	16	44407404	missense	probably damaging	0.99
IGL00952:Cfap44	APN	16	44421275	missense	probably benign	0.33
IGL01340:Cfap44	APN	16	44404130	missense	probably damaging	1.00
IGL01530:Cfap44	APN	16	44449167	missense	probably damaging	1.00
IGL02083:Cfap44	APN	16	44437162	missense	probably damaging	1.00
IGL02088:Cfap44	APN	16	44451628	missense	possibly damaging	0.59
IGL02142:Cfap44	APN	16	44421144	missense	probably benign	0.15
IGL02311:Cfap44	APN	16	44404771	splice site	probably benign
IGL02574:Cfap44	APN	16	44481383	missense	probably damaging	1.00
IGL02893:Cfap44	APN	16	44416817	missense	probably damaging	1.00
IGL02959:Cfap44	APN	16	44470867	splice site	probably benign
IGL03291:Cfap44	APN	16	44407311	missense	possibly damaging	0.86
feldgrau	UTSW	16	44433666	nonsense	probably null
I2288:Cfap44	UTSW	16	44449138	nonsense	probably null
R0023:Cfap44	UTSW	16	44421220	missense	probably benign	0.01
R0023:Cfap44	UTSW	16	44421220	missense	probably benign	0.01
R0036:Cfap44	UTSW	16	44439069	missense	possibly damaging	0.83
R0139:Cfap44	UTSW	16	44433422	missense	possibly damaging	0.90
R0145:Cfap44	UTSW	16	44468372	missense	probably damaging	1.00
R0193:Cfap44	UTSW	16	44449210	splice site	probably null
R0238:Cfap44	UTSW	16	44422318	missense	probably benign
R0238:Cfap44	UTSW	16	44422318	missense	probably benign
R0288:Cfap44	UTSW	16	44415894	splice site	probably benign
R0367:Cfap44	UTSW	16	44433476	critical splice donor site	probably null
R0452:Cfap44	UTSW	16	44431945	missense	probably benign	0.01
R0531:Cfap44	UTSW	16	44401426	start codon destroyed	probably benign	0.01
R0722:Cfap44	UTSW	16	44404676	missense	possibly damaging	0.94
R0801:Cfap44	UTSW	16	44422486	missense	probably benign	0.41
R1209:Cfap44	UTSW	16	44422417	missense	possibly damaging	0.86
R1215:Cfap44	UTSW	16	44419303	missense	probably damaging	1.00
R1385:Cfap44	UTSW	16	44470775	missense	probably damaging	1.00
R1400:Cfap44	UTSW	16	44421212	missense	probably benign	0.01
R1415:Cfap44	UTSW	16	44481389	missense	probably damaging	0.99
R1475:Cfap44	UTSW	16	44433812	splice site	probably benign
R1901:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R1902:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R1903:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R2023:Cfap44	UTSW	16	44416012	missense	probably benign	0.01
R2126:Cfap44	UTSW	16	44410475	missense	probably benign	0.40
R2147:Cfap44	UTSW	16	44451684	missense	probably benign	0.31
R2233:Cfap44	UTSW	16	44451525	missense	probably benign	0.01
R2439:Cfap44	UTSW	16	44481246	unclassified	probably benign
R3015:Cfap44	UTSW	16	44410469	missense	probably benign	0.40
R4178:Cfap44	UTSW	16	44451853	missense	possibly damaging	0.81
R4421:Cfap44	UTSW	16	44422437	missense	probably damaging	1.00
R4516:Cfap44	UTSW	16	44473864	nonsense	probably null
R4742:Cfap44	UTSW	16	44449252	splice site	probably null
R4766:Cfap44	UTSW	16	44415883	splice site	probably null
R4810:Cfap44	UTSW	16	44451535	missense	probably damaging	0.99
R4955:Cfap44	UTSW	16	44475277	missense	possibly damaging	0.75
R5058:Cfap44	UTSW	16	44420204	splice site	probably null
R5164:Cfap44	UTSW	16	44481389	missense	probably damaging	0.99
R5172:Cfap44	UTSW	16	44449193	missense	probably benign
R5344:Cfap44	UTSW	16	44416400	critical splice donor site	probably null
R5519:Cfap44	UTSW	16	44404088	missense	probably damaging	1.00
R5572:Cfap44	UTSW	16	44481305	missense	possibly damaging	0.95
R5601:Cfap44	UTSW	16	44460186	missense	probably damaging	1.00
R5625:Cfap44	UTSW	16	44460347	splice site	probably null
R5638:Cfap44	UTSW	16	44455531	missense	possibly damaging	0.94
R5727:Cfap44	UTSW	16	44435442	missense	probably damaging	0.98
R5950:Cfap44	UTSW	16	44479847	missense	probably damaging	0.99
R6057:Cfap44	UTSW	16	44449097	missense	probably benign	0.03
R6063:Cfap44	UTSW	16	44429892	missense	probably benign	0.00
R6221:Cfap44	UTSW	16	44437186	missense	probably benign	0.13
R6277:Cfap44	UTSW	16	44437306	missense	probably benign	0.04
R6322:Cfap44	UTSW	16	44433666	nonsense	probably null
R6836:Cfap44	UTSW	16	44404079	missense	probably damaging	0.99
R6854:Cfap44	UTSW	16	44449028	critical splice acceptor site	probably null
R6889:Cfap44	UTSW	16	44404132	missense	probably benign	0.03
R7233:Cfap44	UTSW	16	44422408	missense	probably damaging	0.99
R7294:Cfap44	UTSW	16	44404893	intron	probably benign
R7298:Cfap44	UTSW	16	44481412	missense	probably benign	0.04
R7332:Cfap44	UTSW	16	44429828	missense	probably damaging	1.00
R7410:Cfap44	UTSW	16	44468413	missense	probably damaging	1.00
R7455:Cfap44	UTSW	16	44404784	intron	probably benign
R7456:Cfap44	UTSW	16	44431942	missense	probably benign	0.07
R7491:Cfap44	UTSW	16	44470748	missense	probably damaging	1.00
R7698:Cfap44	UTSW	16	44433786	missense	probably damaging	0.99
R7717:Cfap44	UTSW	16	44429935	missense	probably damaging	0.97
R7953:Cfap44	UTSW	16	44413691	missense	probably benign	0.00
R7994:Cfap44	UTSW	16	44432138	missense	probably damaging	0.97
R8043:Cfap44	UTSW	16	44413691	missense	probably benign	0.00
R8238:Cfap44	UTSW	16	44415305	splice site	probably null
R8338:Cfap44	UTSW	16	44419335	critical splice donor site	probably null
R8678:Cfap44	UTSW	16	44475273	missense	probably damaging	1.00
R8680:Cfap44	UTSW	16	44404722	missense	probably damaging	0.98
R8785:Cfap44	UTSW	16	44455532	missense	probably damaging	0.99
R8922:Cfap44	UTSW	16	44451667	missense	probably benign	0.23
R9005:Cfap44	UTSW	16	44460154	missense	probably damaging	1.00
R9020:Cfap44	UTSW	16	44437159	missense	probably damaging	0.99
R9110:Cfap44	UTSW	16	44435560	missense	probably damaging	0.98
R9111:Cfap44	UTSW	16	44431963	missense	probably benign	0.00
R9126:Cfap44	UTSW	16	44475256	missense	possibly damaging	0.77
R9187:Cfap44	UTSW	16	44404781	intron	probably benign
R9194:Cfap44	UTSW	16	44468461	missense	probably damaging	1.00
R9251:Cfap44	UTSW	16	44408913	missense	probably damaging	0.99
R9334:Cfap44	UTSW	16	44419291	missense	probably damaging	0.98
R9336:Cfap44	UTSW	16	44422444	missense	probably damaging	0.97
V1662:Cfap44	UTSW	16	44449138	nonsense	probably null
X0060:Cfap44	UTSW	16	44449074	missense	possibly damaging	0.83
Z1088:Cfap44	UTSW	16	44401466	missense	probably damaging	0.98
Z1177:Cfap44	UTSW	16	44432044	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GAACTCACAGAGAAGGCCTG -3'
(R):5'- TTTCTGTACCCGAGTCCACG -3'

Sequencing Primer
(F):5'- ACAAGAAGTTTTAGTTGCTCTGG -3'
(R):5'- GAGTCCACGTCTTGCAGATC -3'

Posted On

2019-10-24