Incidental Mutation 'R7530:Iqub'
ID583257
Institutional Source Beutler Lab
Gene Symbol Iqub
Ensembl Gene ENSMUSG00000046192
Gene NameIQ motif and ubiquitin domain containing
Synonyms4932408B21Rik, Trs4
MMRRC Submission
Accession Numbers

Genbank: NM_172535; MGI: 3041159

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7530 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24444865-24515067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24450623 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 659 (Q659R)
Ref Sequence ENSEMBL: ENSMUSP00000051177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052277]
Predicted Effect probably benign
Transcript: ENSMUST00000052277
AA Change: Q659R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051177
Gene: ENSMUSG00000046192
AA Change: Q659R

DomainStartEndE-ValueType
PDB:2DAF|A 119 216 1e-38 PDB
Blast:UBQ 129 199 3e-26 BLAST
low complexity region 218 229 N/A INTRINSIC
low complexity region 289 306 N/A INTRINSIC
IQ 333 355 1.74e-1 SMART
low complexity region 357 383 N/A INTRINSIC
low complexity region 735 742 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Chat A T 14: 32,408,958 Y575* probably null Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Ctsr T A 13: 61,163,117 K38N probably damaging Het
Dpm2 T C 2: 32,572,301 F33S probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Ifnar2 A G 16: 91,404,313 S481G probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Kif28 C T 1: 179,708,480 G543D probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Oca2 A C 7: 56,331,972 D614A probably damaging Het
Olfr1 A G 11: 73,388,363 V221A possibly damaging Het
Olfr1058 T A 2: 86,386,171 L82F probably damaging Het
Olfr770 A C 10: 129,133,980 probably null Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rap1b A T 10: 117,817,452 Y159* probably null Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Tomm40 G A 7: 19,702,904 T297I possibly damaging Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Iqub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Iqub APN 6 24501006 splice site probably benign
IGL01447:Iqub APN 6 24505628 missense probably benign 0.01
IGL01621:Iqub APN 6 24446212 missense probably benign 0.45
IGL01702:Iqub APN 6 24500313 missense probably benign 0.13
IGL01917:Iqub APN 6 24479319 missense probably damaging 0.97
IGL02411:Iqub APN 6 24449811 missense probably damaging 0.98
IGL02580:Iqub APN 6 24501399 missense probably benign 0.06
IGL02704:Iqub APN 6 24505910 splice site probably benign
IGL02901:Iqub APN 6 24454195 missense probably damaging 1.00
D4043:Iqub UTSW 6 24505751 missense possibly damaging 0.81
R0304:Iqub UTSW 6 24454291 missense probably damaging 0.99
R0391:Iqub UTSW 6 24446155 missense probably benign 0.00
R0453:Iqub UTSW 6 24450830 missense probably damaging 1.00
R0464:Iqub UTSW 6 24479263 nonsense probably null
R0465:Iqub UTSW 6 24503784 missense probably damaging 1.00
R0479:Iqub UTSW 6 24505810 missense probably benign 0.28
R0606:Iqub UTSW 6 24501261 splice site probably benign
R1146:Iqub UTSW 6 24505628 missense possibly damaging 0.89
R1146:Iqub UTSW 6 24505628 missense possibly damaging 0.89
R1238:Iqub UTSW 6 24505885 missense probably benign 0.03
R1452:Iqub UTSW 6 24491559 missense probably benign 0.13
R1927:Iqub UTSW 6 24491671 missense probably benign 0.11
R3195:Iqub UTSW 6 24462037 splice site probably benign
R4438:Iqub UTSW 6 24505868 missense probably benign 0.01
R4577:Iqub UTSW 6 24501291 missense probably damaging 0.99
R4671:Iqub UTSW 6 24479184 missense probably benign 0.00
R4860:Iqub UTSW 6 24450842 missense probably damaging 0.99
R4860:Iqub UTSW 6 24450842 missense probably damaging 0.99
R4906:Iqub UTSW 6 24501369 missense probably damaging 0.99
R5605:Iqub UTSW 6 24505621 missense probably benign
R5772:Iqub UTSW 6 24454251 missense possibly damaging 0.64
R5801:Iqub UTSW 6 24449769 missense probably benign 0.11
R5853:Iqub UTSW 6 24491602 missense probably benign 0.00
R6423:Iqub UTSW 6 24491529 missense probably damaging 0.98
R6475:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6476:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6477:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6701:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6702:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6703:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6860:Iqub UTSW 6 24505738 missense possibly damaging 0.81
R7331:Iqub UTSW 6 24500394 missense possibly damaging 0.73
R7997:Iqub UTSW 6 24501414 missense possibly damaging 0.86
R8050:Iqub UTSW 6 24503785 missense possibly damaging 0.95
X0025:Iqub UTSW 6 24500384 missense probably damaging 0.96
Z1088:Iqub UTSW 6 24500243 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCTGACAGATAAATTTCACGTGC -3'
(R):5'- GCCAAAATTATTTGCCTTCTGTGG -3'

Sequencing Primer
(F):5'- GAAGAGGGCATCAGATTCCCCTC -3'
(R):5'- GTGGAGTTTTCTGTCTCACCCAC -3'
Posted On2019-10-17