Incidental Mutation 'R7545:Fam135b'
ID584187
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7545 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71450510 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1269 (K1269E)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022953
AA Change: K1269E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: K1269E

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,730,823 E233G probably damaging Het
1700028K03Rik T C 5: 107,548,174 Y159H probably damaging Het
A1cf A T 19: 31,934,790 N435I possibly damaging Het
Aasdh A T 5: 76,880,014 F849I probably damaging Het
Aatf A T 11: 84,470,676 M367K probably benign Het
Acnat1 A T 4: 49,449,142 L208* probably null Het
Adam26b C T 8: 43,521,713 G84D probably damaging Het
Adamtsl1 A T 4: 85,764,855 E54D probably damaging Het
Ang6 T G 14: 44,002,179 I31L probably benign Het
Asic4 A G 1: 75,472,416 N403S probably damaging Het
B020004J07Rik T A 4: 101,837,962 I51L probably benign Het
Bicd1 G A 6: 149,513,492 V568M probably benign Het
Cfap45 A T 1: 172,538,596 M339L probably benign Het
Cnga4 A G 7: 105,407,079 D399G probably damaging Het
Csnk1g3 C T 18: 53,895,825 R17W probably damaging Het
Dnah11 A G 12: 117,931,204 F3636S probably damaging Het
Dscaml1 A T 9: 45,685,383 T842S probably benign Het
Ets2 C A 16: 95,715,083 Q236K probably benign Het
Ext2 C A 2: 93,813,763 V58L probably benign Het
Fech A G 18: 64,464,114 L258P probably damaging Het
Gls A G 1: 52,191,152 S467P probably damaging Het
Gm19410 T A 8: 35,802,625 D1141E probably damaging Het
Gm45861 T G 8: 27,581,004 M1246R unknown Het
Gm6902 T A 7: 23,273,662 I147L probably benign Het
Itga7 G T 10: 128,933,906 probably benign Het
Itpripl1 A T 2: 127,141,661 C180* probably null Het
Klhl33 C A 14: 50,893,174 V28F probably damaging Het
Kmo A T 1: 175,653,628 D304V probably damaging Het
Mier2 T C 10: 79,541,194 N537S possibly damaging Het
Mroh9 A G 1: 163,074,708 I112T possibly damaging Het
Mterf1a T A 5: 3,890,995 E291V probably damaging Het
Muc5ac T A 7: 141,808,668 N1905K unknown Het
Myt1l G A 12: 29,827,088 R246Q unknown Het
Nav2 A G 7: 49,582,857 E1854G probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Nf1 T A 11: 79,409,524 D287E probably benign Het
Nfyc T C 4: 120,773,769 probably null Het
Obscn A T 11: 59,038,899 D5163E probably damaging Het
Olfr945 T A 9: 39,258,688 probably null Het
Olfr961 C T 9: 39,647,107 P127L probably damaging Het
Plppr1 A T 4: 49,320,002 L209F possibly damaging Het
Pmm1 T C 15: 81,951,602 D226G probably damaging Het
Polr1b T A 2: 129,117,846 probably null Het
Ppp2r5a A G 1: 191,372,609 V80A probably benign Het
Psrc1 A G 3: 108,386,443 probably null Het
Ralbp1 T C 17: 65,867,598 T60A probably benign Het
Rasal2 A T 1: 157,192,769 S217T possibly damaging Het
Rnase12 A G 14: 51,056,938 F95L probably damaging Het
Rnf152 A T 1: 105,284,232 I200K probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,927 probably benign Het
Ryk C T 9: 102,888,473 T327I probably damaging Het
Sell A T 1: 164,065,334 T40S probably benign Het
Slc15a2 G A 16: 36,775,602 H153Y probably damaging Het
Slit3 A G 11: 35,700,312 D1317G possibly damaging Het
Slx4 G A 16: 3,999,300 T19M probably benign Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Specc1l T C 10: 75,245,087 S106P probably benign Het
Speer1 C A 5: 11,344,917 Q124K possibly damaging Het
Stc2 T C 11: 31,367,799 N74S probably damaging Het
Strn3 A T 12: 51,627,760 S498T probably damaging Het
Sva C T 6: 42,042,214 T106I probably benign Het
Tle3 T A 9: 61,394,702 L131Q possibly damaging Het
Tmem135 T A 7: 89,305,519 R97W probably damaging Het
Tmx4 A G 2: 134,609,505 L176S possibly damaging Het
Tomm20l C A 12: 71,117,397 probably null Het
Topors A T 4: 40,262,173 F370L possibly damaging Het
Ulk4 T C 9: 121,141,838 T1023A probably benign Het
Unc13a C T 8: 71,641,509 probably null Het
Urb2 T C 8: 124,029,752 S733P probably benign Het
Vwf A G 6: 125,614,097 D750G Het
Xylt1 G A 7: 117,593,585 D373N probably benign Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1415:Fam135b UTSW 15 71456928 missense probably damaging 0.99
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2076:Fam135b UTSW 15 71478243 missense probably damaging 0.99
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5044:Fam135b UTSW 15 71462711 missense probably benign 0.02
R5469:Fam135b UTSW 15 71446043 missense probably benign 0.16
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R5987:Fam135b UTSW 15 71490848 missense probably benign 0.00
R6535:Fam135b UTSW 15 71622075 missense probably damaging 0.99
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71622068 missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7686:Fam135b UTSW 15 71463384 missense possibly damaging 0.68
R7866:Fam135b UTSW 15 71462076 missense probably benign 0.00
R8006:Fam135b UTSW 15 71462334 missense probably benign 0.00
R8068:Fam135b UTSW 15 71532978 missense probably damaging 1.00
R8167:Fam135b UTSW 15 71532991 missense probably null 1.00
R8252:Fam135b UTSW 15 71533023 missense probably benign 0.10
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71622076 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- CAGGTTGAAGAGACACCGCTAG -3'
(R):5'- GTCTCTGTGCACACTCACAC -3'

Sequencing Primer
(F):5'- GTTGAAGAGACACCGCTAGACATC -3'
(R):5'- TCTCTGTGCACACTCACACCTAATAC -3'
Posted On2019-10-17