Incidental Mutation 'R8833:Fam135b'
ID674000
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8833 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71462934 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 804 (N804D)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953]
Predicted Effect probably benign
Transcript: ENSMUST00000022953
AA Change: N804D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: N804D

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik C T 14: 49,773,861 V130I probably benign Het
Akr1c6 T A 13: 4,446,378 D132E possibly damaging Het
Atp10b A G 11: 43,222,159 E844G probably damaging Het
Bbx T A 16: 50,225,266 M311L probably benign Het
Bzw2 A T 12: 36,119,070 M153K probably benign Het
C1qtnf6 G T 15: 78,525,374 T91K probably benign Het
Cdh4 A G 2: 179,894,035 D793G possibly damaging Het
Ces4a A G 8: 105,131,982 I11V probably benign Het
Cpne9 T C 6: 113,304,512 L518P probably damaging Het
Dip2c T A 13: 9,575,483 probably null Het
Fam129a T A 1: 151,644,930 V125E probably damaging Het
Frem3 G A 8: 80,612,772 D565N probably benign Het
Fscb T A 12: 64,473,223 T490S unknown Het
Fuca1 A G 4: 135,920,895 D31G probably damaging Het
Gbp8 G T 5: 105,018,802 N220K possibly damaging Het
Gfra2 T C 14: 70,925,897 F207L probably damaging Het
Gm9495 A T 8: 69,429,330 D331E probably benign Het
Grap2 A G 15: 80,638,483 N70S probably benign Het
Ifna13 C A 4: 88,643,920 E156* probably null Het
Jmjd1c G A 10: 67,218,383 R22H probably benign Het
Macf1 A G 4: 123,471,341 V3209A probably benign Het
Muc5b A G 7: 141,858,368 T1684A unknown Het
Naip5 T A 13: 100,222,934 E598V probably damaging Het
Notch1 G A 2: 26,481,603 T278I probably damaging Het
Olfr1426 A G 19: 12,088,279 V171A possibly damaging Het
Olfr177 A T 16: 58,872,596 Y185N probably damaging Het
Olfr618 T G 7: 103,598,237 F307C possibly damaging Het
Olfr729 A T 14: 50,148,366 C169* probably null Het
Orm1 A T 4: 63,344,701 E35V probably damaging Het
Pak1 T A 7: 97,854,632 I58N possibly damaging Het
Pard3b A G 1: 62,344,999 E841G probably benign Het
Pcdhb9 G T 18: 37,401,415 R154I probably benign Het
Pdpr G A 8: 111,125,680 V560I probably damaging Het
Pkdcc T C 17: 83,223,926 F455L probably damaging Het
Pus7l A T 15: 94,540,262 F234Y probably damaging Het
Rab3gap2 T A 1: 185,258,525 L632Q probably damaging Het
Rarb T A 14: 16,819,015 probably benign Het
Rom1 A T 19: 8,928,107 H236Q possibly damaging Het
Secisbp2 T C 13: 51,665,316 S311P probably benign Het
Slc26a1 T C 5: 108,672,316 D355G probably benign Het
Slc28a3 C T 13: 58,559,263 A574T probably damaging Het
Sox11 A G 12: 27,342,314 V32A possibly damaging Het
Spata17 T C 1: 187,183,239 Y107C probably damaging Het
Speer1 C A 5: 11,344,238 Y104* probably null Het
Stxbp5l T C 16: 37,204,452 T595A probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Tatdn2 T G 6: 113,707,387 I674S probably damaging Het
Tex14 T A 11: 87,493,052 S189R probably benign Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Tor3a T C 1: 156,655,803 T350A probably benign Het
Trove2 T A 1: 143,765,779 K315* probably null Het
Ttr T G 18: 20,666,493 V36G probably damaging Het
Vmn1r129 A T 7: 21,361,280 H4Q probably null Het
Vmn1r32 A G 6: 66,553,639 M51T possibly damaging Het
Zfp141 T C 7: 42,476,263 T262A possibly damaging Het
Zfp980 T A 4: 145,701,026 N108K probably benign Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1415:Fam135b UTSW 15 71456928 missense probably damaging 0.99
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2076:Fam135b UTSW 15 71478243 missense probably damaging 0.99
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5044:Fam135b UTSW 15 71462711 missense probably benign 0.02
R5469:Fam135b UTSW 15 71446043 missense probably benign 0.16
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R5987:Fam135b UTSW 15 71490848 missense probably benign 0.00
R6535:Fam135b UTSW 15 71622075 missense probably damaging 0.99
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71622068 missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7545:Fam135b UTSW 15 71450510 missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7686:Fam135b UTSW 15 71463384 missense possibly damaging 0.68
R7866:Fam135b UTSW 15 71462076 missense probably benign 0.00
R8006:Fam135b UTSW 15 71462334 missense probably benign 0.00
R8068:Fam135b UTSW 15 71532978 missense probably damaging 1.00
R8167:Fam135b UTSW 15 71532991 missense probably null 1.00
R8252:Fam135b UTSW 15 71533023 missense probably benign 0.10
R8548:Fam135b UTSW 15 71462810 missense probably damaging 0.99
R8955:Fam135b UTSW 15 71462214 missense possibly damaging 0.85
R8961:Fam135b UTSW 15 71532963 missense probably damaging 1.00
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71622076 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- CAACATGTAGTGGGGTCTCAGC -3'
(R):5'- CAGTGGCATTCAGGCTTCTC -3'

Sequencing Primer
(F):5'- CCATCCAGACAACAGGGTTCTTG -3'
(R):5'- GTGGCATTCAGGCTTCTCTTTCC -3'
Posted On2021-07-15