Incidental Mutation 'R5044:Fam135b'
ID394276
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
MMRRC Submission 042634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5044 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71462711 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 878 (N878S)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953]
Predicted Effect probably benign
Transcript: ENSMUST00000022953
AA Change: N878S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: N878S

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229634
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1415:Fam135b UTSW 15 71456928 missense probably damaging 0.99
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2076:Fam135b UTSW 15 71478243 missense probably damaging 0.99
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5469:Fam135b UTSW 15 71446043 missense probably benign 0.16
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R5987:Fam135b UTSW 15 71490848 missense probably benign 0.00
R6535:Fam135b UTSW 15 71622075 missense probably damaging 0.99
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71622068 missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7545:Fam135b UTSW 15 71450510 missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7686:Fam135b UTSW 15 71463384 missense possibly damaging 0.68
R7866:Fam135b UTSW 15 71462076 missense probably benign 0.00
R7949:Fam135b UTSW 15 71462076 missense probably benign 0.00
R8006:Fam135b UTSW 15 71462334 missense not run
R8068:Fam135b UTSW 15 71532978 missense not run
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71622076 start codon destroyed not run
Predicted Primers PCR Primer
(F):5'- TTCATGTTTGGCCTCCAGAG -3'
(R):5'- TAGGGCAGGACATTCCCTTG -3'

Sequencing Primer
(F):5'- CCTGTAGAATTCAGGTTGACAGC -3'
(R):5'- GCAGGACATTCCCTTGCAGATATAG -3'
Posted On2016-06-15