Incidental Mutation 'R7097:Fam135b'
ID550586
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7097 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71622068 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 4 (V4A)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953] [ENSMUST00000229189]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022953
AA Change: V4A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: V4A

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229189
AA Change: V4A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,220 N435S probably damaging Het
Aip A T 19: 4,115,381 V195E probably benign Het
Amer3 A T 1: 34,588,788 I703F probably benign Het
Amfr T C 8: 94,012,009 E7G probably benign Het
Angel1 A G 12: 86,726,384 S4P probably damaging Het
Atp2c1 A G 9: 105,464,651 I146T probably damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Bahcc1 T C 11: 120,272,646 V590A possibly damaging Het
Bcl6 A G 16: 23,972,614 V330A possibly damaging Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Btaf1 C T 19: 36,949,102 T58I probably damaging Het
Ccdc175 A T 12: 72,128,409 probably null Het
Cdca4 C A 12: 112,821,569 V180L probably benign Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Clec4g T A 8: 3,719,518 T42S possibly damaging Het
Ctsg A C 14: 56,100,032 I238S probably damaging Het
Cyb5rl A T 4: 107,087,316 E41V unknown Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Dnaaf1 G T 8: 119,596,799 G509V possibly damaging Het
Dnah5 A G 15: 28,453,264 I4394V probably benign Het
Dot1l T G 10: 80,790,726 S1260R probably damaging Het
Dst T G 1: 34,169,260 I1089S probably damaging Het
Eps8l3 A G 3: 107,884,485 probably null Het
Fnip2 T C 3: 79,481,006 E806G probably benign Het
Fryl T A 5: 73,073,908 I1609F probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Hecw2 T A 1: 53,865,124 Y1155F possibly damaging Het
Kif20b T A 19: 34,974,492 N1723K probably damaging Het
Kif2b T C 11: 91,576,824 D211G probably benign Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Med16 C T 10: 79,903,343 G203D probably damaging Het
Mrgpra3 T A 7: 47,589,641 Y179F probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo18b A G 5: 112,874,405 S374P unknown Het
Myoz1 A G 14: 20,649,409 I287T possibly damaging Het
Ncoa6 T C 2: 155,438,063 D11G probably benign Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nmur1 T C 1: 86,387,508 T212A probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G T 2: 36,734,424 M34I probably benign Het
Olfr54 C A 11: 51,027,601 L200I probably benign Het
Olfr891 A T 9: 38,180,336 C162* probably null Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pear1 T G 3: 87,751,445 H901P probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pip5k1b T G 19: 24,358,060 E362D probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Pole T A 5: 110,325,102 probably null Het
Prdm16 G T 4: 154,345,468 T348K probably damaging Het
Prkdc T A 16: 15,689,343 F896I probably damaging Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Ptpn14 G A 1: 189,863,398 W739* probably null Het
Rfx5 G T 3: 94,956,539 G135C probably damaging Het
Scmh1 A G 4: 120,525,055 H573R probably benign Het
Serpina5 G T 12: 104,102,295 probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Slc6a17 C G 3: 107,493,148 G222R probably damaging Het
Sp110 C T 1: 85,579,685 G367D possibly damaging Het
Srcap C A 7: 127,539,041 L1128M probably damaging Het
Tmem189 C G 2: 167,661,478 A7P probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trav6-4 A T 14: 53,454,592 Y52F probably benign Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Trub2 A G 2: 29,779,826 V177A possibly damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Wnk2 C A 13: 49,102,838 R269L possibly damaging Het
Zc3h12c T A 9: 52,115,926 Q731L possibly damaging Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1415:Fam135b UTSW 15 71456928 missense probably damaging 0.99
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2076:Fam135b UTSW 15 71478243 missense probably damaging 0.99
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5044:Fam135b UTSW 15 71462711 missense probably benign 0.02
R5469:Fam135b UTSW 15 71446043 missense probably benign 0.16
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R5987:Fam135b UTSW 15 71490848 missense probably benign 0.00
R6535:Fam135b UTSW 15 71622075 missense probably damaging 0.99
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7545:Fam135b UTSW 15 71450510 missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7686:Fam135b UTSW 15 71463384 missense possibly damaging 0.68
R7866:Fam135b UTSW 15 71462076 missense probably benign 0.00
R7949:Fam135b UTSW 15 71462076 missense probably benign 0.00
R8006:Fam135b UTSW 15 71462334 missense probably benign 0.00
R8068:Fam135b UTSW 15 71532978 missense probably damaging 1.00
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71622076 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- GGGATGAAGGAAATTAGCTCTTAGTC -3'
(R):5'- AACACGGTGTTGCATTGGTC -3'

Sequencing Primer
(F):5'- GAAGGAAATTAGCTCTTAGTCAATGC -3'
(R):5'- ATTGGTCCTGTCAGCCACATGG -3'
Posted On2019-05-15