Incidental Mutation 'R7608:Akr1b7'
ID588432
Institutional Source Beutler Lab
Gene Symbol Akr1b7
Ensembl Gene ENSMUSG00000052131
Gene Namealdo-keto reductase family 1, member B7
SynonymsAvdp, MVDP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7608 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location34412334-34423142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34420522 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 273 (N273S)
Ref Sequence ENSEMBL: ENSMUSP00000007449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007449]
Predicted Effect probably damaging
Transcript: ENSMUST00000007449
AA Change: N273S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007449
Gene: ENSMUSG00000052131
AA Change: N273S

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 294 2.1e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit disrupted progesterone levels during estrous. Mice homozygous for a different knock-out allele exhibit increased basal adiposity and susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Galns A G 8: 122,591,445 F410S probably benign Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Akr1b7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Akr1b7 APN 6 34421117 missense possibly damaging 0.96
IGL02006:Akr1b7 APN 6 34415450 missense probably benign 0.03
IGL02238:Akr1b7 APN 6 34415398 missense probably damaging 1.00
R0393:Akr1b7 UTSW 6 34415400 nonsense probably null
R1809:Akr1b7 UTSW 6 34419111 missense probably damaging 1.00
R2114:Akr1b7 UTSW 6 34418994 missense possibly damaging 0.71
R2115:Akr1b7 UTSW 6 34418994 missense possibly damaging 0.71
R2117:Akr1b7 UTSW 6 34418994 missense possibly damaging 0.71
R4277:Akr1b7 UTSW 6 34421020 intron probably benign
R5396:Akr1b7 UTSW 6 34412476 critical splice donor site probably null
R5504:Akr1b7 UTSW 6 34419518 splice site probably null
R6181:Akr1b7 UTSW 6 34415378 missense possibly damaging 0.71
R6657:Akr1b7 UTSW 6 34416200 missense probably damaging 1.00
R6815:Akr1b7 UTSW 6 34412334 utr 5 prime probably null
R7211:Akr1b7 UTSW 6 34421114 missense probably benign 0.39
R7246:Akr1b7 UTSW 6 34415469 missense probably benign 0.04
R7417:Akr1b7 UTSW 6 34417365 splice site probably null
R7572:Akr1b7 UTSW 6 34419408 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGAAAAGTATCCCTAATGGTGAAG -3'
(R):5'- ACCTGTGAGCTCAGTCATCC -3'

Sequencing Primer
(F):5'- GGTGAAGGGCTTTGTTAATATCAAC -3'
(R):5'- GAGCTCAGTCATCCCAGCTTTCTAG -3'
Posted On2019-10-24