Incidental Mutation 'R7608:Galns'
ID588443
Institutional Source Beutler Lab
Gene Symbol Galns
Ensembl Gene ENSMUSG00000015027
Gene Namegalactosamine (N-acetyl)-6-sulfate sulfatase
SynonymsN-acetylgalactosamine-6-sulfate sulfatase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7608 (G1)
Quality Score213.009
Status Validated
Chromosome8
Chromosomal Location122578242-122611463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122591445 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 410 (F410S)
Ref Sequence ENSEMBL: ENSMUSP00000015171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015171] [ENSMUST00000127664] [ENSMUST00000212319]
Predicted Effect probably benign
Transcript: ENSMUST00000015171
AA Change: F410S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000015171
Gene: ENSMUSG00000015027
AA Change: F410S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 28 353 2.3e-91 PFAM
Pfam:Phosphodiest 30 315 2.1e-11 PFAM
Pfam:Sulfatase_C 376 507 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212319
Meta Mutation Damage Score 0.1890 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes N-acetylgalactosamine-6-sulfatase which is a lysosomal exohydrolase required for the degradation of the glycosaminoglycans, keratan sulfate, and chondroitin 6-sulfate. Sequence alterations including point, missense and nonsense mutations, as well as those that affect splicing, result in a deficiency of this enzyme. Deficiencies of this enzyme lead to Morquio A syndrome, a lysosomal storage disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile, and healthy in spite of lysosmal storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,177,703 F311S probably benign Het
Adamts7 C A 9: 90,173,773 T193N possibly damaging Het
Akr1b7 A G 6: 34,420,522 N273S probably damaging Het
Asz1 G A 6: 18,077,253 T151M probably damaging Het
Atrnl1 T A 19: 57,714,687 Y1046N probably damaging Het
Cacna2d1 T C 5: 16,359,024 S902P probably damaging Het
Casp3 T A 8: 46,634,333 I105K probably benign Het
Ccdc146 C T 5: 21,301,452 V664I probably benign Het
Cfap61 G A 2: 145,963,531 C267Y possibly damaging Het
Dgkz A T 2: 91,934,054 probably null Het
Dnah11 G T 12: 118,140,770 probably null Het
Duox1 C A 2: 122,326,135 Y514* probably null Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam214b A G 4: 43,036,533 L66P probably damaging Het
Fan1 A T 7: 64,354,231 probably null Het
Fgfrl1 A T 5: 108,705,345 K278M probably damaging Het
Fign T C 2: 63,978,719 I736V possibly damaging Het
Hspbp1 C A 7: 4,660,822 K341N possibly damaging Het
Idh3b A T 2: 130,280,980 S296R probably damaging Het
Ifi44 A G 3: 151,732,408 F414S probably damaging Het
Kdm3a T A 6: 71,600,747 M690L probably benign Het
Lrrc49 C T 9: 60,602,722 G488S probably null Het
Mcc T C 18: 44,491,227 N417S possibly damaging Het
Melk T A 4: 44,325,571 probably null Het
Mtcl1 T C 17: 66,343,305 R1722G probably damaging Het
Olfr1252 A G 2: 89,721,298 V271A probably benign Het
Olfr1475 G A 19: 13,479,592 T202I possibly damaging Het
Olfr562-ps1 A G 7: 102,781,925 I150V probably benign Het
Olfr924 T A 9: 38,848,510 V132D possibly damaging Het
Pdzrn3 T C 6: 101,151,752 E651G probably damaging Het
Pop5 A G 5: 115,237,872 probably benign Het
Prox1 T A 1: 190,153,445 M602L probably benign Het
Prpf39 G A 12: 65,053,446 A298T probably benign Het
Scg2 T C 1: 79,436,181 E275G probably benign Het
Scn11a A T 9: 119,815,313 probably null Het
Slc16a4 A T 3: 107,303,127 Y371F probably damaging Het
Slc4a1ap T A 5: 31,536,189 M489K possibly damaging Het
Spata13 A G 14: 60,692,507 N505D possibly damaging Het
Tas2r129 A G 6: 132,951,193 N31S probably damaging Het
Tmem159 A G 7: 120,104,788 K19E probably damaging Het
Tnn A T 1: 160,088,414 Y1508* probably null Het
Trim23 T C 13: 104,192,033 V354A probably benign Het
Tsc1 A T 2: 28,658,736 T18S probably benign Het
Txlnb A G 10: 17,815,398 K232R probably damaging Het
Vmn1r53 C T 6: 90,224,122 M73I probably benign Het
Vmn1r67 G A 7: 10,447,363 V185M possibly damaging Het
Vmn2r14 A G 5: 109,221,410 I99T probably benign Het
Zfp318 T G 17: 46,400,009 V886G probably damaging Het
Zfp760 A G 17: 21,722,816 N324S probably benign Het
Zfp819 T C 7: 43,616,933 V280A probably benign Het
Other mutations in Galns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Galns APN 8 122598626 missense probably damaging 1.00
IGL02401:Galns APN 8 122605199 missense probably damaging 1.00
brimstone UTSW 8 122600610 missense probably damaging 1.00
fiend UTSW 8 122611338 start codon destroyed probably null
vesuvius UTSW 8 122599348 splice site probably null
R0001:Galns UTSW 8 122595883 splice site probably benign
R0018:Galns UTSW 8 122584985 missense probably benign 0.09
R1417:Galns UTSW 8 122584913 missense possibly damaging 0.71
R1636:Galns UTSW 8 122604216 splice site probably benign
R4729:Galns UTSW 8 122603456 missense probably damaging 1.00
R4851:Galns UTSW 8 122600533 missense probably damaging 1.00
R4891:Galns UTSW 8 122599156 missense possibly damaging 0.92
R5218:Galns UTSW 8 122598589 missense probably damaging 0.99
R5532:Galns UTSW 8 122585026 missense possibly damaging 0.83
R6323:Galns UTSW 8 122598651 missense probably damaging 1.00
R6444:Galns UTSW 8 122611338 start codon destroyed probably null
R6495:Galns UTSW 8 122600610 missense probably damaging 1.00
R7215:Galns UTSW 8 122599348 splice site probably null
R7612:Galns UTSW 8 122584954 missense possibly damaging 0.71
Z1177:Galns UTSW 8 122598523 missense probably benign 0.11
Z1177:Galns UTSW 8 122605206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCTACATCTGGACATCTAGGC -3'
(R):5'- ATGTCAGCCGATACCTACCC -3'

Sequencing Primer
(F):5'- TCTGGACATCTAGGCATGAAAAC -3'
(R):5'- GGAGGCATGGGCAGCTC -3'
Posted On2019-10-24