Incidental Mutation 'R7612:Rexo1'
ID588674
Institutional Source Beutler Lab
Gene Symbol Rexo1
Ensembl Gene ENSMUSG00000047417
Gene NameREX1, RNA exonuclease 1
Synonyms2610511M11Rik, Tceb3bp1, 1700021P10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R7612 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80540922-80561560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 80549663 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 520 (S520R)
Ref Sequence ENSEMBL: ENSMUSP00000049705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057910]
Predicted Effect probably benign
Transcript: ENSMUST00000057910
AA Change: S520R

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049705
Gene: ENSMUSG00000047417
AA Change: S520R

DomainStartEndE-ValueType
low complexity region 34 53 N/A INTRINSIC
coiled coil region 83 113 N/A INTRINSIC
low complexity region 180 188 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
low complexity region 507 525 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
low complexity region 561 583 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
Pfam:EloA-BP1 794 954 3.8e-72 PFAM
EXOIII 1051 1210 2.36e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182260
Predicted Effect probably benign
Transcript: ENSMUST00000183073
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,608 Y181* probably null Het
Adgrf2 T G 17: 42,714,380 K71T possibly damaging Het
Brca2 T A 5: 150,540,611 M1280K probably benign Het
Card14 T C 11: 119,333,579 S541P possibly damaging Het
Ccdc144b A T 3: 36,025,357 S261R possibly damaging Het
Cd19 G T 7: 126,414,324 Q98K possibly damaging Het
Ceacam5 T A 7: 17,759,416 I788N possibly damaging Het
Cpne2 A T 8: 94,557,420 I290L probably benign Het
Cpsf1 C T 15: 76,597,009 V1216I probably benign Het
Csad G A 15: 102,188,922 probably benign Het
Depdc7 T A 2: 104,730,508 Q47L probably benign Het
Dnajc6 T A 4: 101,597,926 S105T probably benign Het
Dsg4 C A 18: 20,470,990 P838Q probably damaging Het
Efcab3 T A 11: 105,108,821 Y179N possibly damaging Het
Egfr A T 11: 16,859,025 N73I possibly damaging Het
Eya2 T C 2: 165,687,737 probably null Het
Fubp1 A G 3: 152,218,015 Q123R possibly damaging Het
Galns A G 8: 122,584,954 I439T possibly damaging Het
Gsdmd T G 15: 75,864,954 L140R probably damaging Het
Hcrtr1 A G 4: 130,135,685 V201A possibly damaging Het
Ildr2 T A 1: 166,307,792 M371K probably benign Het
Kalrn G A 16: 34,314,212 T412I possibly damaging Het
Kdm5b C T 1: 134,624,918 Q1211* probably null Het
Loxhd1 T C 18: 77,429,975 S1840P possibly damaging Het
Maml2 A G 9: 13,706,485 M376V probably benign Het
Mgat4e T C 1: 134,542,007 T100A probably damaging Het
Myo18b T A 5: 112,865,302 T812S possibly damaging Het
Nanp T A 2: 151,039,238 E30V probably null Het
Olfr1212 T G 2: 88,958,505 L13R probably damaging Het
Olfr1369-ps1 G T 13: 21,116,047 M118I probably damaging Het
Olfr203 A T 16: 59,303,627 H158L probably damaging Het
Parp3 T A 9: 106,474,194 N241I probably benign Het
Piezo2 T C 18: 63,042,539 N1924D probably benign Het
Pou1f1 A G 16: 65,529,925 N137S probably damaging Het
Ptgdr A G 14: 44,858,637 M206T probably damaging Het
Ptprd T C 4: 76,086,459 T20A probably benign Het
Sgip1 T A 4: 102,869,808 S94T probably benign Het
Slc35e3 A G 10: 117,740,880 V182A probably benign Het
Slfn2 A G 11: 83,070,263 E356G probably damaging Het
Spry4 C A 18: 38,589,929 K260N probably damaging Het
Sync A T 4: 129,293,582 M136L probably benign Het
Tm7sf2 A G 19: 6,070,608 V425A probably benign Het
Trim21 T A 7: 102,559,535 M326L probably benign Het
Trim62 A G 4: 128,896,884 Q158R probably benign Het
Tubgcp2 T A 7: 140,001,051 K663M probably damaging Het
Uggt1 T C 1: 36,163,235 I1094V probably damaging Het
Urb1 A G 16: 90,797,910 S245P probably damaging Het
Vwa3a A T 7: 120,752,615 D34V probably null Het
Zbtb45 C T 7: 13,007,399 A311T possibly damaging Het
Zfp655 T C 5: 145,237,189 S135P unknown Het
Other mutations in Rexo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Rexo1 APN 10 80550964 missense probably damaging 0.99
IGL01128:Rexo1 APN 10 80549739 missense probably benign
IGL01890:Rexo1 APN 10 80543011 missense possibly damaging 0.85
PIT4453001:Rexo1 UTSW 10 80550397 missense probably damaging 0.97
R0044:Rexo1 UTSW 10 80544378 missense probably benign 0.16
R0365:Rexo1 UTSW 10 80542576 missense probably damaging 0.99
R0573:Rexo1 UTSW 10 80544850 missense probably damaging 1.00
R1146:Rexo1 UTSW 10 80544405 missense probably benign 0.04
R1146:Rexo1 UTSW 10 80544405 missense probably benign 0.04
R1511:Rexo1 UTSW 10 80550050 missense possibly damaging 0.93
R1523:Rexo1 UTSW 10 80542751 missense probably benign 0.41
R1807:Rexo1 UTSW 10 80542579 missense possibly damaging 0.95
R1868:Rexo1 UTSW 10 80542920 missense probably damaging 1.00
R1935:Rexo1 UTSW 10 80550469 missense probably benign 0.00
R1936:Rexo1 UTSW 10 80550469 missense probably benign 0.00
R1957:Rexo1 UTSW 10 80543366 missense probably damaging 0.96
R2084:Rexo1 UTSW 10 80561266 missense probably benign 0.01
R2153:Rexo1 UTSW 10 80544109 nonsense probably null
R2262:Rexo1 UTSW 10 80549569 missense probably benign 0.02
R4471:Rexo1 UTSW 10 80542658 missense probably damaging 1.00
R4472:Rexo1 UTSW 10 80542658 missense probably damaging 1.00
R4690:Rexo1 UTSW 10 80546421 missense probably benign 0.01
R4972:Rexo1 UTSW 10 80549693 missense probably damaging 0.96
R6335:Rexo1 UTSW 10 80544081 missense probably damaging 1.00
R6505:Rexo1 UTSW 10 80543011 missense possibly damaging 0.85
R6615:Rexo1 UTSW 10 80544014 missense possibly damaging 0.68
R6949:Rexo1 UTSW 10 80550636 missense possibly damaging 0.46
R7807:Rexo1 UTSW 10 80550136 missense probably benign 0.09
R7840:Rexo1 UTSW 10 80550738 missense probably benign
R8779:Rexo1 UTSW 10 80548458 missense probably benign 0.26
R8897:Rexo1 UTSW 10 80542603 missense probably damaging 0.98
Z1177:Rexo1 UTSW 10 80549775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTAGTCCACATCCTCCTCTG -3'
(R):5'- AGAAGCTGCCAGCCAGTAAC -3'

Sequencing Primer
(F):5'- TCCTCTGCACACTGGCTGG -3'
(R):5'- ATCCTCTGCGACCACAGTG -3'
Posted On2019-10-24