Incidental Mutation 'R7612:Cpsf1'
ID588683
Institutional Source Beutler Lab
Gene Symbol Cpsf1
Ensembl Gene ENSMUSG00000034022
Gene Namecleavage and polyadenylation specific factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R7612 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76595803-76607591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76597009 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1216 (V1216I)
Ref Sequence ENSEMBL: ENSMUSP00000071794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000160784] [ENSMUST00000161612] [ENSMUST00000161732] [ENSMUST00000162503] [ENSMUST00000230157] [ENSMUST00000231042]
Predicted Effect probably benign
Transcript: ENSMUST00000071898
AA Change: V1216I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: V1216I

DomainStartEndE-ValueType
Pfam:MMS1_N 92 684 7.2e-42 PFAM
low complexity region 902 910 N/A INTRINSIC
Pfam:CPSF_A 1071 1407 4.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160784
SMART Domains Protein: ENSMUSP00000124666
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 9.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161612
SMART Domains Protein: ENSMUSP00000124701
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161732
SMART Domains Protein: ENSMUSP00000125482
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162503
SMART Domains Protein: ENSMUSP00000125055
Gene: ENSMUSG00000022550

DomainStartEndE-ValueType
transmembrane domain 50 69 N/A INTRINSIC
Pfam:ABC1 188 304 2.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229287
Predicted Effect probably benign
Transcript: ENSMUST00000230157
AA Change: V1216I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000231042
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A T 16: 88,773,608 Y181* probably null Het
Adgrf2 T G 17: 42,714,380 K71T possibly damaging Het
Brca2 T A 5: 150,540,611 M1280K probably benign Het
Card14 T C 11: 119,333,579 S541P possibly damaging Het
Ccdc144b A T 3: 36,025,357 S261R possibly damaging Het
Cd19 G T 7: 126,414,324 Q98K possibly damaging Het
Ceacam5 T A 7: 17,759,416 I788N possibly damaging Het
Cpne2 A T 8: 94,557,420 I290L probably benign Het
Csad G A 15: 102,188,922 probably benign Het
Depdc7 T A 2: 104,730,508 Q47L probably benign Het
Dnajc6 T A 4: 101,597,926 S105T probably benign Het
Dsg4 C A 18: 20,470,990 P838Q probably damaging Het
Efcab3 T A 11: 105,108,821 Y179N possibly damaging Het
Egfr A T 11: 16,859,025 N73I possibly damaging Het
Eya2 T C 2: 165,687,737 probably null Het
Fubp1 A G 3: 152,218,015 Q123R possibly damaging Het
Galns A G 8: 122,584,954 I439T possibly damaging Het
Gsdmd T G 15: 75,864,954 L140R probably damaging Het
Hcrtr1 A G 4: 130,135,685 V201A possibly damaging Het
Ildr2 T A 1: 166,307,792 M371K probably benign Het
Kalrn G A 16: 34,314,212 T412I possibly damaging Het
Kdm5b C T 1: 134,624,918 Q1211* probably null Het
Loxhd1 T C 18: 77,429,975 S1840P possibly damaging Het
Maml2 A G 9: 13,706,485 M376V probably benign Het
Mgat4e T C 1: 134,542,007 T100A probably damaging Het
Myo18b T A 5: 112,865,302 T812S possibly damaging Het
Nanp T A 2: 151,039,238 E30V probably null Het
Olfr1212 T G 2: 88,958,505 L13R probably damaging Het
Olfr1369-ps1 G T 13: 21,116,047 M118I probably damaging Het
Olfr203 A T 16: 59,303,627 H158L probably damaging Het
Parp3 T A 9: 106,474,194 N241I probably benign Het
Piezo2 T C 18: 63,042,539 N1924D probably benign Het
Pou1f1 A G 16: 65,529,925 N137S probably damaging Het
Ptgdr A G 14: 44,858,637 M206T probably damaging Het
Ptprd T C 4: 76,086,459 T20A probably benign Het
Rexo1 G C 10: 80,549,663 S520R probably benign Het
Sgip1 T A 4: 102,869,808 S94T probably benign Het
Slc35e3 A G 10: 117,740,880 V182A probably benign Het
Slfn2 A G 11: 83,070,263 E356G probably damaging Het
Spry4 C A 18: 38,589,929 K260N probably damaging Het
Sync A T 4: 129,293,582 M136L probably benign Het
Tm7sf2 A G 19: 6,070,608 V425A probably benign Het
Trim21 T A 7: 102,559,535 M326L probably benign Het
Trim62 A G 4: 128,896,884 Q158R probably benign Het
Tubgcp2 T A 7: 140,001,051 K663M probably damaging Het
Uggt1 T C 1: 36,163,235 I1094V probably damaging Het
Urb1 A G 16: 90,797,910 S245P probably damaging Het
Vwa3a A T 7: 120,752,615 D34V probably null Het
Zbtb45 C T 7: 13,007,399 A311T possibly damaging Het
Zfp655 T C 5: 145,237,189 S135P unknown Het
Other mutations in Cpsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cpsf1 APN 15 76600216 missense probably benign 0.27
IGL01013:Cpsf1 APN 15 76599297 nonsense probably null
IGL01599:Cpsf1 APN 15 76596541 missense probably damaging 1.00
IGL02008:Cpsf1 APN 15 76603091 missense probably damaging 1.00
IGL02291:Cpsf1 APN 15 76602821 missense probably damaging 1.00
IGL02901:Cpsf1 APN 15 76599496 nonsense probably null
IGL02929:Cpsf1 APN 15 76602127 critical splice donor site probably null
IGL03402:Cpsf1 APN 15 76596003 splice site probably null
R0005:Cpsf1 UTSW 15 76600680 critical splice donor site probably null
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0487:Cpsf1 UTSW 15 76597002 missense probably damaging 1.00
R0510:Cpsf1 UTSW 15 76603657 intron probably benign
R0630:Cpsf1 UTSW 15 76601971 missense probably damaging 1.00
R0780:Cpsf1 UTSW 15 76600377 missense probably benign 0.17
R1617:Cpsf1 UTSW 15 76602370 nonsense probably null
R1717:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R1889:Cpsf1 UTSW 15 76602156 missense probably benign 0.06
R1994:Cpsf1 UTSW 15 76603160 missense probably benign 0.03
R2168:Cpsf1 UTSW 15 76603737 missense possibly damaging 0.69
R2359:Cpsf1 UTSW 15 76597673 missense probably benign 0.02
R2697:Cpsf1 UTSW 15 76599329 missense probably damaging 1.00
R2847:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R2848:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R3409:Cpsf1 UTSW 15 76601781 nonsense probably null
R3410:Cpsf1 UTSW 15 76601781 nonsense probably null
R3815:Cpsf1 UTSW 15 76601149 missense probably benign 0.22
R4030:Cpsf1 UTSW 15 76601779 missense possibly damaging 0.96
R4491:Cpsf1 UTSW 15 76597722 missense possibly damaging 0.85
R4615:Cpsf1 UTSW 15 76596937 missense possibly damaging 0.88
R5227:Cpsf1 UTSW 15 76598948 missense probably damaging 1.00
R5353:Cpsf1 UTSW 15 76602571 missense probably damaging 1.00
R5548:Cpsf1 UTSW 15 76597327 missense possibly damaging 0.95
R5552:Cpsf1 UTSW 15 76599646 missense probably benign 0.27
R5746:Cpsf1 UTSW 15 76599837 missense probably benign 0.01
R6319:Cpsf1 UTSW 15 76596967 missense probably damaging 1.00
R6360:Cpsf1 UTSW 15 76597455 frame shift probably null
R6572:Cpsf1 UTSW 15 76597455 frame shift probably null
R6574:Cpsf1 UTSW 15 76597455 frame shift probably null
R6576:Cpsf1 UTSW 15 76597455 frame shift probably null
R6577:Cpsf1 UTSW 15 76597455 frame shift probably null
R6588:Cpsf1 UTSW 15 76596822 missense probably damaging 1.00
R6595:Cpsf1 UTSW 15 76602510 missense probably damaging 1.00
R6621:Cpsf1 UTSW 15 76603519 missense probably damaging 1.00
R6880:Cpsf1 UTSW 15 76602539 missense probably benign 0.06
R6954:Cpsf1 UTSW 15 76599496 missense probably damaging 1.00
R7100:Cpsf1 UTSW 15 76596114 missense possibly damaging 0.73
R7255:Cpsf1 UTSW 15 76597543 missense probably damaging 1.00
R7318:Cpsf1 UTSW 15 76597275 nonsense probably null
R7371:Cpsf1 UTSW 15 76600575 missense probably damaging 1.00
R7387:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R7446:Cpsf1 UTSW 15 76601750 missense probably benign
R7739:Cpsf1 UTSW 15 76600311 missense probably benign 0.00
R7878:Cpsf1 UTSW 15 76600500 missense probably damaging 1.00
R7961:Cpsf1 UTSW 15 76600500 missense probably damaging 1.00
X0052:Cpsf1 UTSW 15 76596302 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTCCACCATGAAGTCCACG -3'
(R):5'- GGTCCTGTATGAGAAGGAGC -3'

Sequencing Primer
(F):5'- TGAAGTCCACGCTGTATACC -3'
(R):5'- TTGGCCAAAAAGTGTGTGACCTC -3'
Posted On2019-10-24