Incidental Mutation 'R7618:Dok1'
ID588996
Institutional Source Beutler Lab
Gene Symbol Dok1
Ensembl Gene ENSMUSG00000068335
Gene Namedocking protein 1
Synonymsp62DOK
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7618 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location83030934-83033471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83032891 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 79 (E79G)
Ref Sequence ENSEMBL: ENSMUSP00000087079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000089651] [ENSMUST00000101257] [ENSMUST00000113980] [ENSMUST00000149918]
PDB Structure
Crystal Structure of Dok1 PTB Domain [X-RAY DIFFRACTION]
Crystal Structure of Dok1 PTB Domain Complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000000707
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089651
AA Change: E79G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000087079
Gene: ENSMUSG00000068335
AA Change: E79G

DomainStartEndE-ValueType
PH 4 121 1.31e-8 SMART
IRS 151 254 1.21e-45 SMART
PTBI 152 254 3.84e-59 SMART
low complexity region 411 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101257
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113980
SMART Domains Protein: ENSMUSP00000109613
Gene: ENSMUSG00000030041

DomainStartEndE-ValueType
low complexity region 151 163 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 482 500 N/A INTRINSIC
low complexity region 504 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149918
Predicted Effect probably benign
Transcript: ENSMUST00000204891
Predicted Effect probably benign
Transcript: ENSMUST00000204900
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a signal transduction pathway downstream of receptor tyrosine kinases. The encoded protein is a scaffold protein that helps form a platform for the assembly of multiprotein signaling complexes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display mild abnormalities in myeloid cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Dok1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Dok1 APN 6 83032562 missense probably damaging 1.00
IGL01680:Dok1 APN 6 83031312 missense possibly damaging 0.91
IGL02076:Dok1 APN 6 83032831 missense probably damaging 1.00
IGL02341:Dok1 APN 6 83033054 missense probably damaging 1.00
IGL02706:Dok1 APN 6 83032334 missense probably damaging 1.00
R0417:Dok1 UTSW 6 83031569 missense probably damaging 1.00
R1169:Dok1 UTSW 6 83032048 missense possibly damaging 0.90
R1859:Dok1 UTSW 6 83032245 missense probably damaging 1.00
R5007:Dok1 UTSW 6 83032316 missense probably damaging 1.00
R5048:Dok1 UTSW 6 83032106 intron probably benign
Predicted Primers PCR Primer
(F):5'- TAGGTGCAAGAAGTCCAGTGC -3'
(R):5'- TCGTTCTTTCCCAGAGGTGG -3'

Sequencing Primer
(F):5'- GAAGTCCAGTGCCTCTATAATAGCTC -3'
(R):5'- GAGGAAAACTTGGGCTGTGCTTTAC -3'
Posted On2019-10-24