Incidental Mutation 'R7618:Ankrd60'
ID 628168
Institutional Source Beutler Lab
Gene Symbol Ankrd60
Ensembl Gene ENSMUSG00000027517
Gene Name ankyrin repeat domain 60
Synonyms 1700019A24Rik, 1700030G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 173568666-173578365 bp(-) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) T to C at 173571041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109112] [ENSMUST00000119453]
AlphaFold A2AMD2
Predicted Effect probably null
Transcript: ENSMUST00000109112
SMART Domains Protein: ENSMUSP00000104740
Gene: ENSMUSG00000027517

DomainStartEndE-ValueType
ANK 73 102 2.83e0 SMART
ANK 106 135 2.13e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119453
SMART Domains Protein: ENSMUSP00000113291
Gene: ENSMUSG00000027517

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Blast:UBQ 70 142 5e-39 BLAST
ANK 193 222 2.83e0 SMART
ANK 226 255 2.13e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Ankrd60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Ankrd60 APN 2 173571203 missense probably benign 0.33
R0060:Ankrd60 UTSW 2 173572613 start codon destroyed probably null 1.00
R0060:Ankrd60 UTSW 2 173572613 start codon destroyed probably null 1.00
R0569:Ankrd60 UTSW 2 173571066 missense probably damaging 1.00
R0587:Ankrd60 UTSW 2 173568851 missense possibly damaging 0.83
R2941:Ankrd60 UTSW 2 173568881 missense probably damaging 1.00
R4549:Ankrd60 UTSW 2 173572602 missense possibly damaging 0.89
R5322:Ankrd60 UTSW 2 173568817 missense possibly damaging 0.76
R5763:Ankrd60 UTSW 2 173578089 frame shift probably null
R5786:Ankrd60 UTSW 2 173578089 frame shift probably null
R5787:Ankrd60 UTSW 2 173578089 frame shift probably null
R5788:Ankrd60 UTSW 2 173578089 frame shift probably null
R7527:Ankrd60 UTSW 2 173578173 missense probably benign 0.00
R7756:Ankrd60 UTSW 2 173568769 makesense probably null
R7758:Ankrd60 UTSW 2 173568769 makesense probably null
R8039:Ankrd60 UTSW 2 173572491 critical splice donor site probably null
R9345:Ankrd60 UTSW 2 173568817 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCCACAGATCTGGCCTAGAGAAG -3'
(R):5'- ATGCAGGTCACGCTCTAGAG -3'

Sequencing Primer
(F):5'- CCTAGAGAAGTGCAAGTCCCTG -3'
(R):5'- CTAGAGGCAGCCTTGATGTATTCC -3'
Posted On 2020-01-28