Incidental Mutation 'R7618:Clnk'
ID588991
Institutional Source Beutler Lab
Gene Symbol Clnk
Ensembl Gene ENSMUSG00000039315
Gene Namecytokine-dependent hematopoietic cell linker
SynonymsMIST
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7618 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location38706462-38876812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38736355 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 220 (S220T)
Ref Sequence ENSEMBL: ENSMUSP00000128473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169819] [ENSMUST00000171633]
Predicted Effect probably benign
Transcript: ENSMUST00000169819
AA Change: S220T

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128473
Gene: ENSMUSG00000039315
AA Change: S220T

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171633
AA Change: S220T

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000132779
Gene: ENSMUSG00000039315
AA Change: S220T

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MIST is a member of the SLP76 family of adaptors (see LCP2, MIM 601603; BLNK, MIM 604515). MIST plays a role in the regulation of immunoreceptor signaling, including PLC-gamma (PLCG1; MIM 172420)-mediated B cell antigen receptor (BCR) signaling and FC-epsilon R1 (see FCER1A, MIM 147140)-mediated mast cell degranulation (Cao et al., 1999 [PubMed 10562326]; Goitsuka et al., 2000, 2001 [PubMed 10744659] [PubMed 11463797]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a reporter allele display altered natural killer (NK) T cell physiology and enhanced NK cell cytolysis. Mice homozygous for knock-out allele display abnormal mast cell physiology as well as enhanced NK cell cytolysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Ogfod3 C A 11: 121,202,978 V69F probably damaging Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Clnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Clnk APN 5 38784528 missense possibly damaging 0.95
IGL01348:Clnk APN 5 38713207 missense probably damaging 1.00
IGL01901:Clnk APN 5 38794978 missense probably damaging 1.00
IGL01908:Clnk APN 5 38713142 missense probably damaging 1.00
IGL02437:Clnk APN 5 38774566 critical splice donor site probably null
IGL02745:Clnk APN 5 38736319 missense probably benign 0.00
R0138:Clnk UTSW 5 38774608 splice site probably benign
R0196:Clnk UTSW 5 38769939 missense probably damaging 0.97
R1522:Clnk UTSW 5 38794966 missense probably damaging 1.00
R1958:Clnk UTSW 5 38706626 missense possibly damaging 0.96
R2036:Clnk UTSW 5 38752800 splice site probably null
R2238:Clnk UTSW 5 38764351 splice site probably benign
R3788:Clnk UTSW 5 38714998 missense probably damaging 1.00
R3931:Clnk UTSW 5 38768069 missense probably benign
R4159:Clnk UTSW 5 38741795 intron probably benign
R4182:Clnk UTSW 5 38747850 intron probably benign
R4686:Clnk UTSW 5 38741837 intron probably benign
R4751:Clnk UTSW 5 38720913 missense probably benign 0.06
R4842:Clnk UTSW 5 38713069 splice site probably null
R5811:Clnk UTSW 5 38713147 missense probably damaging 1.00
R6236:Clnk UTSW 5 38713199 missense probably benign 0.41
R7157:Clnk UTSW 5 38769891 missense possibly damaging 0.63
R7615:Clnk UTSW 5 38706698 missense probably damaging 1.00
R7762:Clnk UTSW 5 38768141 missense probably benign 0.24
R7768:Clnk UTSW 5 38768158 missense probably damaging 1.00
R7823:Clnk UTSW 5 38750351 missense probably benign 0.00
R8158:Clnk UTSW 5 38794911 critical splice donor site probably null
R8423:Clnk UTSW 5 38794910 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCATGTTTTCCAGAACAGAAGG -3'
(R):5'- GGGAAAATCCAGTAATGTGTGC -3'

Sequencing Primer
(F):5'- CAGAACAGAAGGTCAAAAATTTCCTG -3'
(R):5'- GGAAAATCCAGTAATGTGTGCTTTAC -3'
Posted On2019-10-24