Incidental Mutation 'R7618:Ogfod3'
ID 589011
Institutional Source Beutler Lab
Gene Symbol Ogfod3
Ensembl Gene ENSMUSG00000025169
Gene Name 2-oxoglutarate and iron-dependent oxygenase domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R7618 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 121177591-121204711 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 121202978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 69 (V69F)
Ref Sequence ENSEMBL: ENSMUSP00000026169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026169] [ENSMUST00000038831] [ENSMUST00000106117] [ENSMUST00000124768]
AlphaFold Q9D136
Predicted Effect probably damaging
Transcript: ENSMUST00000026169
AA Change: V69F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026169
Gene: ENSMUSG00000025169
AA Change: V69F

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
P4Hc 104 302 1.82e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038831
SMART Domains Protein: ENSMUSP00000048479
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 30 223 2.9e-12 PFAM
low complexity region 528 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106117
SMART Domains Protein: ENSMUSP00000101723
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 31 229 1.7e-18 PFAM
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124768
SMART Domains Protein: ENSMUSP00000122008
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 22 152 8.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151495
SMART Domains Protein: ENSMUSP00000123073
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 27 220 3.1e-12 PFAM
low complexity region 525 535 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,584,550 C602W possibly damaging Het
4930432K21Rik A G 8: 84,166,870 Q222R possibly damaging Het
Akap11 T C 14: 78,498,860 D1830G Het
Alms1 A G 6: 85,678,417 N2846S probably benign Het
Amt A C 9: 108,299,878 E228D probably damaging Het
Ankar T C 1: 72,675,766 M618V probably benign Het
Ankrd60 T C 2: 173,571,041 probably null Het
Aoc1 A G 6: 48,906,386 T399A possibly damaging Het
Aqp11 T A 7: 97,737,666 I108F probably benign Het
Arfgef3 G T 10: 18,646,281 Q666K probably damaging Het
Bin2 T A 15: 100,645,013 R430W probably damaging Het
Cdh18 T A 15: 23,366,970 V254D probably damaging Het
Cfap46 A T 7: 139,603,239 S159R Het
Clnk A T 5: 38,736,355 S220T probably benign Het
Col19a1 G T 1: 24,322,084 H608Q probably benign Het
Cplx1 C T 5: 108,525,529 E24K possibly damaging Het
Dnah3 A T 7: 119,978,378 L2031Q probably damaging Het
Dok1 T C 6: 83,032,891 E79G probably benign Het
Eif4g3 T C 4: 138,171,118 S902P probably damaging Het
Emilin3 T A 2: 160,909,279 E183D probably benign Het
Fam124b G A 1: 80,213,837 probably benign Het
Gm9195 T C 14: 72,452,835 Y1816C probably damaging Het
Ighv5-9-1 T A 12: 113,736,199 I98F probably damaging Het
Il31ra G A 13: 112,551,980 P21L possibly damaging Het
Kat6a A G 8: 22,862,562 I121V possibly damaging Het
Kif11 T C 19: 37,411,560 W832R probably benign Het
Klhl9 T C 4: 88,720,535 T490A possibly damaging Het
Lars G T 18: 42,244,891 A153E probably benign Het
Muc5b A T 7: 141,867,597 I4275L probably benign Het
Myo10 T A 15: 25,726,475 C294* probably null Het
Nceh1 T A 3: 27,183,217 probably null Het
Ncf1 T A 5: 134,227,267 T93S probably benign Het
Nfatc2 G A 2: 168,534,999 R545C probably damaging Het
Nos1 C T 5: 117,903,944 P545S probably benign Het
Olfr1197 A T 2: 88,728,836 Y254* probably null Het
Phf12 A G 11: 78,026,134 N272S unknown Het
Prkcz T A 4: 155,262,482 I581F probably damaging Het
Rasgrf2 T C 13: 91,987,966 H8R Het
Rb1cc1 T A 1: 6,265,558 probably null Het
Rcor2 T A 19: 7,271,046 M186K possibly damaging Het
Rnf111 C A 9: 70,503,332 probably benign Het
Serinc3 A T 2: 163,630,969 F247Y possibly damaging Het
Serpina1c T A 12: 103,898,770 I206F probably damaging Het
Slc25a10 G A 11: 120,496,971 probably null Het
Syne2 T G 12: 75,945,334 H1993Q probably benign Het
Tap1 A G 17: 34,188,238 Y120C possibly damaging Het
Tex30 A T 1: 44,088,250 probably null Het
Ube2ql1 G T 13: 69,738,947 Q132K probably benign Het
Unc13d T C 11: 116,066,721 N803D probably damaging Het
Vcan G A 13: 89,692,223 S1734F probably damaging Het
Wdfy4 T C 14: 32,985,739 Y2630C Het
Wdr93 A G 7: 79,785,726 T668A probably benign Het
Other mutations in Ogfod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Ogfod3 APN 11 121203025 missense probably benign 0.06
IGL02398:Ogfod3 APN 11 121203025 missense probably benign 0.06
IGL02458:Ogfod3 APN 11 121200923 missense probably benign 0.22
IGL03411:Ogfod3 APN 11 121177804 makesense probably null
PIT4403001:Ogfod3 UTSW 11 121196735 critical splice donor site probably null
R0145:Ogfod3 UTSW 11 121195070 splice site probably benign
R1302:Ogfod3 UTSW 11 121183474 missense probably damaging 1.00
R3926:Ogfod3 UTSW 11 121183429 missense probably damaging 1.00
R4823:Ogfod3 UTSW 11 121195201 missense probably benign 0.42
R4825:Ogfod3 UTSW 11 121195201 missense probably benign 0.42
R4909:Ogfod3 UTSW 11 121197492 missense probably damaging 1.00
R6378:Ogfod3 UTSW 11 121202935 missense probably benign 0.01
R6953:Ogfod3 UTSW 11 121202998 missense probably benign
R7051:Ogfod3 UTSW 11 121195205 missense probably damaging 0.99
R7741:Ogfod3 UTSW 11 121183536 critical splice acceptor site probably null
R8112:Ogfod3 UTSW 11 121204550 missense probably damaging 1.00
R8714:Ogfod3 UTSW 11 121196782 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GCTGAGTTTCATTTCTGTCACG -3'
(R):5'- TAGTATGATGGCTGCATCCAG -3'

Sequencing Primer
(F):5'- TCTCCTGAAGGTGAAGTTACAGGC -3'
(R):5'- CCAGTGGCTGGTTATCGTCTC -3'
Posted On 2019-10-24