Incidental Mutation 'R7725:Fam35a'
ID595462
Institutional Source Beutler Lab
Gene Symbol Fam35a
Ensembl Gene ENSMUSG00000041471
Gene Namefamily with sequence similarity 35, member A
Synonyms3110001K24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34237033-34310493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34268704 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 82 (T82P)
Ref Sequence ENSEMBL: ENSMUSP00000107548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111917] [ENSMUST00000227006] [ENSMUST00000227375] [ENSMUST00000228337] [ENSMUST00000228626] [ENSMUST00000228704]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111917
AA Change: T82P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107548
Gene: ENSMUSG00000041471
AA Change: T82P

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
Pfam:FAM35_C 694 866 4.6e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227006
Predicted Effect possibly damaging
Transcript: ENSMUST00000227375
AA Change: T82P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228337
AA Change: T82P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228626
AA Change: T82P

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000228704
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Other mutations in Fam35a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Fam35a APN 14 34268625 missense probably benign 0.02
IGL00962:Fam35a APN 14 34249251 missense probably damaging 1.00
IGL01288:Fam35a APN 14 34259643 missense probably benign 0.00
IGL01302:Fam35a APN 14 34259727 missense probably benign 0.03
IGL01312:Fam35a APN 14 34268193 missense possibly damaging 0.56
IGL01444:Fam35a APN 14 34237557 missense probably damaging 1.00
IGL01633:Fam35a APN 14 34249179 missense probably damaging 1.00
IGL02251:Fam35a APN 14 34268278 missense probably benign 0.10
IGL02927:Fam35a APN 14 34267701 missense probably damaging 1.00
IGL03183:Fam35a APN 14 34245186 missense probably benign 0.02
IGL03226:Fam35a APN 14 34268371 missense probably benign 0.08
R0111:Fam35a UTSW 14 34267729 missense probably damaging 0.98
R1170:Fam35a UTSW 14 34268491 missense possibly damaging 0.92
R1348:Fam35a UTSW 14 34268923 missense probably damaging 1.00
R1467:Fam35a UTSW 14 34268662 missense possibly damaging 0.92
R1467:Fam35a UTSW 14 34268662 missense possibly damaging 0.92
R1538:Fam35a UTSW 14 34268876 missense probably damaging 1.00
R1602:Fam35a UTSW 14 34267650 missense probably damaging 1.00
R1650:Fam35a UTSW 14 34259617 intron probably benign
R1777:Fam35a UTSW 14 34268173 missense probably benign 0.07
R1843:Fam35a UTSW 14 34267803 missense probably benign 0.01
R2425:Fam35a UTSW 14 34268689 missense probably damaging 0.96
R3837:Fam35a UTSW 14 34249185 missense probably damaging 0.99
R3838:Fam35a UTSW 14 34245368 missense probably benign 0.01
R3904:Fam35a UTSW 14 34259709 missense probably damaging 1.00
R3964:Fam35a UTSW 14 34259687 missense probably damaging 1.00
R4322:Fam35a UTSW 14 34259675 missense probably damaging 0.99
R4708:Fam35a UTSW 14 34267833 missense probably benign 0.17
R4771:Fam35a UTSW 14 34268706 missense probably damaging 1.00
R4838:Fam35a UTSW 14 34268625 missense probably benign 0.02
R5448:Fam35a UTSW 14 34268370 missense probably benign 0.32
R5874:Fam35a UTSW 14 34245258 missense probably benign 0.08
R6332:Fam35a UTSW 14 34268172 missense probably benign 0.07
R6333:Fam35a UTSW 14 34267608 missense probably damaging 1.00
R6476:Fam35a UTSW 14 34268014 missense probably benign 0.27
R6576:Fam35a UTSW 14 34268242 missense probably damaging 1.00
R7172:Fam35a UTSW 14 34237568 missense probably damaging 1.00
R7574:Fam35a UTSW 14 34237466 missense probably damaging 1.00
R7755:Fam35a UTSW 14 34248890 missense probably damaging 0.99
R7840:Fam35a UTSW 14 34237566 missense probably damaging 1.00
R7881:Fam35a UTSW 14 34267767 missense possibly damaging 0.63
R7923:Fam35a UTSW 14 34237566 missense probably damaging 1.00
R7964:Fam35a UTSW 14 34267767 missense possibly damaging 0.63
X0009:Fam35a UTSW 14 34245186 missense probably benign 0.02
Z1177:Fam35a UTSW 14 34241471 missense not run
Z1177:Fam35a UTSW 14 34268598 missense not run
Predicted Primers PCR Primer
(F):5'- AAGTTCCGAACGCAGGGATC -3'
(R):5'- GGAACAGCTTCCTTAATGTCCAC -3'

Sequencing Primer
(F):5'- AACGCAGGGATCTGACTGATTTTTAG -3'
(R):5'- TTAATGTCCACTGCCAACGC -3'
Posted On2019-11-12