Incidental Mutation 'R7725:Zfp994'
ID595466
Institutional Source Beutler Lab
Gene Symbol Zfp994
Ensembl Gene ENSMUSG00000096433
Gene Namezinc finger protein 994
SynonymsGm4944
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7725 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location22197265-22225614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22200110 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 619 (N619K)
Ref Sequence ENSEMBL: ENSMUSP00000136105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179996]
Predicted Effect probably benign
Transcript: ENSMUST00000179996
AA Change: N619K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000136105
Gene: ENSMUSG00000096433
AA Change: N619K

DomainStartEndE-ValueType
KRAB 13 73 3.33e-20 SMART
ZnF_C2H2 183 205 8.09e-1 SMART
ZnF_C2H2 211 233 1.84e-4 SMART
ZnF_C2H2 239 261 2.99e-4 SMART
ZnF_C2H2 267 289 1.04e-3 SMART
ZnF_C2H2 295 317 2.61e-4 SMART
ZnF_C2H2 323 345 4.3e-5 SMART
ZnF_C2H2 351 373 6.78e-3 SMART
ZnF_C2H2 379 401 1.12e-3 SMART
ZnF_C2H2 407 429 5.5e-3 SMART
ZnF_C2H2 435 457 1.3e-4 SMART
ZnF_C2H2 463 485 1.67e-2 SMART
ZnF_C2H2 491 513 1.47e-3 SMART
ZnF_C2H2 519 541 2.4e-3 SMART
ZnF_C2H2 547 569 7.67e-2 SMART
ZnF_C2H2 575 597 8.6e-5 SMART
ZnF_C2H2 603 625 8.02e-5 SMART
ZnF_C2H2 631 653 9.22e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,608,499 N164K probably benign Het
Anxa2 A T 9: 69,480,128 K6N unknown Het
Arhgap20 T A 9: 51,831,750 M296K possibly damaging Het
Bdh1 G A 16: 31,438,092 V20I not run Het
Bop1 A G 15: 76,455,383 I254T probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc114 T A 7: 45,948,411 S582T probably damaging Het
Cct4 A G 11: 22,990,814 K21E probably benign Het
Cercam G A 2: 29,872,562 probably null Het
Clip2 A T 5: 134,517,999 Y238* probably null Het
Col19a1 A T 1: 24,270,444 S1043T possibly damaging Het
Ctcf A G 8: 105,663,836 Y25C probably damaging Het
Dennd4c C T 4: 86,786,093 R282C probably benign Het
Eef1g T A 19: 8,978,063 H425Q probably benign Het
Fam131b C T 6: 42,318,542 A234T probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam187b A G 7: 30,977,714 D216G possibly damaging Het
Fam35a T G 14: 34,268,704 T82P possibly damaging Het
Gabra1 A T 11: 42,135,443 Y341N possibly damaging Het
Gm14124 A G 2: 150,268,548 Y386C unknown Het
Gm3667 T A 14: 6,874,268 Q52L probably damaging Het
Gpr179 C T 11: 97,351,292 R242H probably damaging Het
Gulo T C 14: 66,008,073 Y24C probably damaging Het
Hectd4 A T 5: 121,220,617 E49V unknown Het
Htra4 A G 8: 25,037,153 S209P possibly damaging Het
Lmntd1 A G 6: 145,543,470 S22P probably benign Het
Med12l A G 3: 59,255,992 K1347E probably damaging Het
Mrc1 C A 2: 14,279,977 D592E probably benign Het
Muc15 A G 2: 110,731,798 D193G probably damaging Het
Ncor2 A G 5: 125,023,566 V1316A Het
Olfr1101 T C 2: 86,988,979 I66V probably benign Het
Olfr1380 A T 11: 49,564,532 I204L probably benign Het
Olfr224 A G 11: 58,566,767 Y193H probably damaging Het
Serpina6 A T 12: 103,648,677 Y303* probably null Het
Shroom3 T C 5: 92,941,653 L754P probably benign Het
Skint5 C A 4: 113,827,902 L539F unknown Het
St3gal4 C A 9: 35,053,079 R209L possibly damaging Het
Tex14 A C 11: 87,495,042 T243P probably damaging Het
Ttc12 T A 9: 49,440,302 M632L probably benign Het
Ttn T C 2: 76,907,772 E4187G unknown Het
Txk G A 5: 72,707,557 A379V probably damaging Het
Wdr43 A G 17: 71,616,343 Y28C probably benign Het
Zfp40 A G 17: 23,178,277 V82A probably benign Het
Other mutations in Zfp994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03065:Zfp994 APN 17 22202680 missense probably damaging 0.98
R0361:Zfp994 UTSW 17 22200110 missense probably benign 0.01
R0498:Zfp994 UTSW 17 22200901 missense probably damaging 0.99
R0567:Zfp994 UTSW 17 22200468 missense possibly damaging 0.82
R1075:Zfp994 UTSW 17 22200945 missense probably damaging 1.00
R1561:Zfp994 UTSW 17 22201225 missense probably damaging 1.00
R2117:Zfp994 UTSW 17 22200981 missense probably damaging 1.00
R2313:Zfp994 UTSW 17 22201285 missense probably damaging 1.00
R4486:Zfp994 UTSW 17 22201560 missense probably damaging 1.00
R4906:Zfp994 UTSW 17 22200467 nonsense probably null
R4924:Zfp994 UTSW 17 22200757 missense probably damaging 0.98
R5394:Zfp994 UTSW 17 22200525 missense probably damaging 1.00
R5560:Zfp994 UTSW 17 22201713 missense possibly damaging 0.62
R5746:Zfp994 UTSW 17 22201273 missense probably damaging 0.99
R6275:Zfp994 UTSW 17 22199991 nonsense probably null
R6459:Zfp994 UTSW 17 22200546 missense possibly damaging 0.83
R6668:Zfp994 UTSW 17 22201100 missense probably damaging 1.00
R7343:Zfp994 UTSW 17 22200068 missense probably benign 0.12
R7625:Zfp994 UTSW 17 22201755 missense possibly damaging 0.85
R7709:Zfp994 UTSW 17 22200425 missense probably benign 0.00
R7756:Zfp994 UTSW 17 22200847 missense possibly damaging 0.89
R7758:Zfp994 UTSW 17 22200847 missense possibly damaging 0.89
R8033:Zfp994 UTSW 17 22200684 missense not run
Predicted Primers PCR Primer
(F):5'- AGGTCTGAGATTTGGGTAAAGACC -3'
(R):5'- GCTCAGGTGTCATCGGATTATTC -3'

Sequencing Primer
(F):5'- TGCAGGTAAAGCATTTGTCAC -3'
(R):5'- CAGGTGTCATCGGATTATTCATACAG -3'
Posted On2019-11-12