Incidental Mutation 'R7734:Usp13'
ID596036
Institutional Source Beutler Lab
Gene Symbol Usp13
Ensembl Gene ENSMUSG00000056900
Gene Nameubiquitin specific peptidase 13 (isopeptidase T-3)
SynonymsISOT3, 2700071E21Rik, IsoT-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7734 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location32817546-32938071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32837905 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 78 (H78Y)
Ref Sequence ENSEMBL: ENSMUSP00000072155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072312] [ENSMUST00000108228] [ENSMUST00000172481]
Predicted Effect probably benign
Transcript: ENSMUST00000072312
AA Change: H78Y

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072155
Gene: ENSMUSG00000056900
AA Change: H78Y

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
low complexity region 625 639 N/A INTRINSIC
UBA 652 690 1.25e-6 SMART
UBA 724 761 1.19e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108228
AA Change: H78Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103863
Gene: ENSMUSG00000056900
AA Change: H78Y

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 115 133 N/A INTRINSIC
ZnF_UBP 207 262 2.91e-20 SMART
low complexity region 624 638 N/A INTRINSIC
UBA 651 689 1.25e-6 SMART
UBA 723 760 1.19e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172481
AA Change: H78Y

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133823
Gene: ENSMUSG00000056900
AA Change: H78Y

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 9e-18 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
Pfam:UCH 333 523 5.1e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T A 18: 12,189,263 I591N possibly damaging Het
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Cyp4a12b C A 4: 115,411,740 Q20K possibly damaging Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Dcp1b A G 6: 119,215,283 S387G probably benign Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Edem3 T C 1: 151,818,585 S890P probably benign Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mest T C 6: 30,746,300 Y296H unknown Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mfsd4b1 A T 10: 40,007,378 N25K probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pcdh7 T G 5: 57,719,634 I177S probably damaging Het
Pde6a T C 18: 61,232,866 I221T probably benign Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rpl4 T A 9: 64,177,379 H245Q probably benign Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tcf12 C A 9: 71,922,661 V173L probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in Usp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Usp13 APN 3 32881411 missense probably damaging 0.98
IGL00949:Usp13 APN 3 32886577 missense possibly damaging 0.57
IGL01637:Usp13 APN 3 32919064 missense probably benign 0.02
IGL01983:Usp13 APN 3 32917459 missense probably damaging 1.00
IGL02002:Usp13 APN 3 32847825 missense probably damaging 0.97
IGL02065:Usp13 APN 3 32933165 missense probably damaging 1.00
IGL02390:Usp13 APN 3 32931716 nonsense probably null
IGL02399:Usp13 APN 3 32919060 missense probably damaging 1.00
IGL02535:Usp13 APN 3 32837926 missense probably benign 0.43
IGL02863:Usp13 APN 3 32918947 missense possibly damaging 0.95
IGL03017:Usp13 APN 3 32915712 missense possibly damaging 0.90
IGL03242:Usp13 APN 3 32902069 missense probably benign 0.17
PIT4504001:Usp13 UTSW 3 32905430 missense probably damaging 1.00
R0113:Usp13 UTSW 3 32817876 splice site probably benign
R0233:Usp13 UTSW 3 32915664 splice site probably null
R0233:Usp13 UTSW 3 32915664 splice site probably null
R1241:Usp13 UTSW 3 32915708 missense probably damaging 1.00
R1765:Usp13 UTSW 3 32915770 missense probably benign 0.01
R2105:Usp13 UTSW 3 32901986 missense probably damaging 0.97
R2229:Usp13 UTSW 3 32917551 missense probably benign 0.02
R2381:Usp13 UTSW 3 32881509 critical splice donor site probably null
R2389:Usp13 UTSW 3 32905464 missense probably benign 0.16
R3801:Usp13 UTSW 3 32881508 missense possibly damaging 0.75
R4062:Usp13 UTSW 3 32881423 missense probably damaging 1.00
R4653:Usp13 UTSW 3 32837924 missense probably damaging 0.99
R5123:Usp13 UTSW 3 32915798 missense probably benign 0.03
R5454:Usp13 UTSW 3 32905436 missense probably damaging 1.00
R5527:Usp13 UTSW 3 32865838 missense probably damaging 1.00
R5582:Usp13 UTSW 3 32911589 missense probably damaging 1.00
R5589:Usp13 UTSW 3 32837858 missense probably damaging 1.00
R5829:Usp13 UTSW 3 32886523 missense possibly damaging 0.68
R6114:Usp13 UTSW 3 32854669 missense probably damaging 1.00
R6625:Usp13 UTSW 3 32894876 missense probably damaging 0.98
R6680:Usp13 UTSW 3 32881469 missense probably damaging 0.98
R7175:Usp13 UTSW 3 32917608 nonsense probably null
R7232:Usp13 UTSW 3 32865871 missense probably benign 0.05
R7242:Usp13 UTSW 3 32865743 splice site probably null
R7263:Usp13 UTSW 3 32894851 missense probably damaging 1.00
R7533:Usp13 UTSW 3 32918942 missense probably damaging 0.99
R7716:Usp13 UTSW 3 32837856 nonsense probably null
R7943:Usp13 UTSW 3 32876940 missense probably damaging 1.00
R8075:Usp13 UTSW 3 32931703 missense probably damaging 1.00
R8141:Usp13 UTSW 3 32894876 missense possibly damaging 0.52
R8259:Usp13 UTSW 3 32917599 nonsense probably null
R8722:Usp13 UTSW 3 32901965 missense probably benign 0.00
R8905:Usp13 UTSW 3 32881423 missense probably damaging 1.00
X0064:Usp13 UTSW 3 32886589 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCCATCTTCGGTTCTGGC -3'
(R):5'- AGGAAGCTCTGAGAGTCTGC -3'

Sequencing Primer
(F):5'- AGAGTCACTGTAACCCTTTGCTGAG -3'
(R):5'- TCTGAGAGTCTGCACGCTG -3'
Posted On2019-11-12