Mutagenetix > Incidental Mutations

Incidental Mutation 'R7746:4932414N04Rik'

596828

Institutional Source

Beutler Lab

Gene Symbol

4932414N04Rik

Ensembl Gene

ENSMUSG00000079324

Gene Name

RIKEN cDNA 4932414N04 gene

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7746 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

68656486-68748467 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68728995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 184 (Q184L)

Ref Sequence

ENSEMBL: ENSMUSP00000135792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055930] [ENSMUST00000128259]

AlphaFold

Q8CEQ9

Predicted Effect

probably benign
Transcript: ENSMUST00000055930
AA Change: Q184L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000059809
Gene: ENSMUSG00000079324
AA Change: Q184L

Domain	Start	End	E-Value	Type
coiled coil region	154	241	N/A	INTRINSIC
Pfam:DUF3496	265	361	8.5e-12	PFAM
internal_repeat_1	456	597	1.76e-26	PROSPERO
internal_repeat_1	601	737	1.76e-26	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000128259
AA Change: Q184L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000135792
Gene: ENSMUSG00000079324
AA Change: Q184L

Domain	Start	End	E-Value	Type
internal_repeat_1	5	39	6.02e-5	PROSPERO
internal_repeat_1	209	242	6.02e-5	PROSPERO
low complexity region	286	297	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624G23Rik	T	G	12: 24,074,673	S68R	possibly damaging	Het
Acyp1	G	T	12: 85,279,058	R56S	unknown	Het
Angpt2	C	T	8: 18,692,064	R492Q	probably damaging	Het
Ankrd36	T	C	11: 5,687,451	L1340P	possibly damaging	Het
Arhgef33	G	C	17: 80,347,120		probably null	Het
Bach1	G	A	16: 87,729,633	S661N	probably benign	Het
Bik	T	C	15: 83,541,334	I12T	possibly damaging	Het
C3	C	T	17: 57,218,859	R841H	probably damaging	Het
Cacna1s	G	T	1: 136,069,018	R119L	probably damaging	Het
Cic	G	A	7: 25,288,782	V1632M	probably damaging	Het
Ctif	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	18: 75,471,803		probably benign	Het
Dchs2	A	G	3: 83,128,057	H37R	possibly damaging	Het
Dvl1	A	G	4: 155,856,239	I439V	possibly damaging	Het
Fam19a1	T	C	6: 96,115,756		probably null	Het
Fat1	G	A	8: 44,951,633	D474N	probably damaging	Het
Foxs1	T	A	2: 152,933,108	E8D	probably benign	Het
Garnl3	T	C	2: 32,992,257	D822G	probably damaging	Het
Gm11397	A	T	13: 33,397,858	I133L	probably damaging	Het
Gm11756	C	T	4: 73,919,862	S29N	possibly damaging	Het
Gm44501	C	T	17: 40,578,829	A78V	possibly damaging	Het
Gpr19	C	A	6: 134,869,392	A443S	probably damaging	Het
Helb	T	C	10: 120,095,102	R729G	probably null	Het
Lnpep	G	T	17: 17,538,562	T840K	probably benign	Het
Mctp2	T	C	7: 72,185,796	N551S	probably benign	Het
Mgam	T	G	6: 40,668,193	F635V	probably damaging	Het
Mlc1	G	A	15: 88,964,170	A262V	probably damaging	Het
Muc5b	A	G	7: 141,862,239	Y2974C	probably benign	Het
Nprl3	A	T	11: 32,248,150	Y208*	probably null	Het
Olfr1090	A	T	2: 86,754,093	L215Q	probably damaging	Het
Olfr136	C	T	17: 38,335,394	P79L	probably benign	Het
Pkn2	A	G	3: 142,794,107	F915S	probably damaging	Het
Pkn3	G	A	2: 30,090,584	C829Y	probably benign	Het
Polr1a	C	T	6: 71,941,512	P685S	probably damaging	Het
Ppp4r3b	A	G	11: 29,173,352	D16G	probably benign	Het
Ppwd1	C	T	13: 104,217,206	R348H	probably damaging	Het
Pxdc1	T	C	13: 34,639,063	T98A	probably benign	Het
Rhbdl1	T	C	17: 25,836,193	I68V	probably benign	Het
Ror2	A	G	13: 53,117,225	C365R	probably damaging	Het
Samd4b	A	T	7: 28,403,903	H43Q	probably damaging	Het
Sbf2	A	T	7: 110,441,426	V398D	probably benign	Het
Sbno2	T	C	10: 80,058,874	I1012M	probably damaging	Het
Strn	T	C	17: 78,677,372	T281A	probably benign	Het
Syt4	T	A	18: 31,444,265	D12V	probably benign	Het
Tmem45a	A	G	16: 56,825,737	L40P	probably damaging	Het
Tnn	G	A	1: 160,114,685	P1081L	probably damaging	Het
Unc80	T	C	1: 66,677,385	V2888A	probably benign	Het

Other mutations in 4932414N04Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:4932414N04Rik	APN	2	68732875	missense	probably benign	0.02
IGL01384:4932414N04Rik	APN	2	68745405	missense	possibly damaging	0.53
IGL02170:4932414N04Rik	APN	2	68731123	missense	probably benign	0.02
IGL02650:4932414N04Rik	APN	2	68741537	missense	probably benign	0.00
IGL02707:4932414N04Rik	APN	2	68731130	missense	possibly damaging	0.71
IGL02737:4932414N04Rik	APN	2	68736560	missense	possibly damaging	0.53
IGL03351:4932414N04Rik	APN	2	68731083	missense	probably benign
R0328:4932414N04Rik	UTSW	2	68744280	missense	possibly damaging	0.53
R0362:4932414N04Rik	UTSW	2	68732917	missense	probably benign	0.00
R0638:4932414N04Rik	UTSW	2	68717228	missense	probably benign	0.18
R1201:4932414N04Rik	UTSW	2	68716282	missense	possibly damaging	0.53
R1381:4932414N04Rik	UTSW	2	68731086	missense	probably benign	0.18
R1456:4932414N04Rik	UTSW	2	68716214	missense	possibly damaging	0.86
R2001:4932414N04Rik	UTSW	2	68741456	missense	probably benign
R2051:4932414N04Rik	UTSW	2	68711048	missense	possibly damaging	0.72
R2228:4932414N04Rik	UTSW	2	68729591	missense	probably benign	0.00
R2292:4932414N04Rik	UTSW	2	68732139	missense	probably benign	0.00
R2357:4932414N04Rik	UTSW	2	68739500	missense	possibly damaging	0.86
R2484:4932414N04Rik	UTSW	2	68711475	missense	possibly damaging	0.85
R3035:4932414N04Rik	UTSW	2	68745418	missense	probably benign	0.00
R3916:4932414N04Rik	UTSW	2	68731985	missense	possibly damaging	0.71
R3950:4932414N04Rik	UTSW	2	68664403	critical splice donor site	probably null
R3951:4932414N04Rik	UTSW	2	68664403	critical splice donor site	probably null
R3952:4932414N04Rik	UTSW	2	68664403	critical splice donor site	probably null
R4091:4932414N04Rik	UTSW	2	68745378	missense	possibly damaging	0.73
R4118:4932414N04Rik	UTSW	2	68736513	missense	probably benign
R4153:4932414N04Rik	UTSW	2	68668597	intron	probably benign
R4210:4932414N04Rik	UTSW	2	68659878	start gained	probably benign
R4614:4932414N04Rik	UTSW	2	68745460	missense	probably benign	0.01
R4818:4932414N04Rik	UTSW	2	68741466	missense	probably benign
R5202:4932414N04Rik	UTSW	2	68731964	missense	probably benign
R5466:4932414N04Rik	UTSW	2	68711389	missense	probably benign	0.11
R5585:4932414N04Rik	UTSW	2	68741426	missense	probably benign	0.00
R5602:4932414N04Rik	UTSW	2	68748368	makesense	probably null
R5846:4932414N04Rik	UTSW	2	68732033	missense	unknown
R5902:4932414N04Rik	UTSW	2	68708937	start codon destroyed	probably null
R6002:4932414N04Rik	UTSW	2	68662424	splice site	probably null
R6029:4932414N04Rik	UTSW	2	68694026	splice site	probably null
R6093:4932414N04Rik	UTSW	2	68659870	splice site	probably benign
R6168:4932414N04Rik	UTSW	2	68741483	missense	possibly damaging	0.86
R6300:4932414N04Rik	UTSW	2	68731109	missense	possibly damaging	0.96
R6322:4932414N04Rik	UTSW	2	68729499	missense	probably benign	0.00
R6533:4932414N04Rik	UTSW	2	68716318	nonsense	probably null
R6547:4932414N04Rik	UTSW	2	68659907	utr 5 prime	probably benign
R7309:4932414N04Rik	UTSW	2	68716186	missense	probably benign	0.29
R7400:4932414N04Rik	UTSW	2	68666203	missense	unknown
R7454:4932414N04Rik	UTSW	2	68688304	missense	unknown
R7481:4932414N04Rik	UTSW	2	68664231	missense	unknown
R7498:4932414N04Rik	UTSW	2	68667668	missense	unknown
R7523:4932414N04Rik	UTSW	2	68662480	missense	unknown
R7523:4932414N04Rik	UTSW	2	68739329	missense	probably benign	0.01
R7583:4932414N04Rik	UTSW	2	68739326	missense	probably damaging	0.98
R7701:4932414N04Rik	UTSW	2	68731204	missense	possibly damaging	0.60
R7778:4932414N04Rik	UTSW	2	68739511	missense	possibly damaging	0.73
R7985:4932414N04Rik	UTSW	2	68664349	missense	unknown
R8525:4932414N04Rik	UTSW	2	68729034	missense	possibly damaging	0.83
R8765:4932414N04Rik	UTSW	2	68736612	missense	possibly damaging	0.85
R8906:4932414N04Rik	UTSW	2	68732154	missense	possibly damaging	0.85
R9406:4932414N04Rik	UTSW	2	68667675	missense	unknown
X0025:4932414N04Rik	UTSW	2	68729016	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GACTTTGCCAGCCATAAGATCC -3'
(R):5'- CTCTGAGCTGCTTCCAAAATCC -3'

Sequencing Primer
(F):5'- GCCAGCCATAAGATCCCTGTTG -3'
(R):5'- TGAGCTGCTTCCAAAATCCTAAGTAC -3'

Posted On

2019-11-26