Incidental Mutation 'R7746:Syt4'
ID596868
Institutional Source Beutler Lab
Gene Symbol Syt4
Ensembl Gene ENSMUSG00000024261
Gene Namesynaptotagmin IV
Synonyms
Accession Numbers

Genbank: NM_009308; MGI: 101759  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7746 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location31437808-31447415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31444265 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 12 (D12V)
Ref Sequence ENSEMBL: ENSMUSP00000025110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025110]
Predicted Effect probably benign
Transcript: ENSMUST00000025110
AA Change: D12V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025110
Gene: ENSMUSG00000024261
AA Change: D12V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 137 150 N/A INTRINSIC
C2 169 273 1.5e-19 SMART
C2 303 417 3.5e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the synaptotagmin family. Members of this family are multi-domained, integral membrane proteins of synaptic vesicles, and are thought to serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis. This gene is primarily expressed in the nervous tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impairments in motor coordination, contextual fear conditioning, and social transmission of food preference. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,728,995 Q184L probably benign Het
9030624G23Rik T G 12: 24,074,673 S68R possibly damaging Het
Acyp1 G T 12: 85,279,058 R56S unknown Het
Angpt2 C T 8: 18,692,064 R492Q probably damaging Het
Ankrd36 T C 11: 5,687,451 L1340P possibly damaging Het
Arhgef33 G C 17: 80,347,120 probably null Het
Bach1 G A 16: 87,729,633 S661N probably benign Het
Bik T C 15: 83,541,334 I12T possibly damaging Het
C3 C T 17: 57,218,859 R841H probably damaging Het
Cacna1s G T 1: 136,069,018 R119L probably damaging Het
Cic G A 7: 25,288,782 V1632M probably damaging Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dchs2 A G 3: 83,128,057 H37R possibly damaging Het
Dvl1 A G 4: 155,856,239 I439V possibly damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fat1 G A 8: 44,951,633 D474N probably damaging Het
Foxs1 T A 2: 152,933,108 E8D probably benign Het
Garnl3 T C 2: 32,992,257 D822G probably damaging Het
Gm11397 A T 13: 33,397,858 I133L probably damaging Het
Gm11756 C T 4: 73,919,862 S29N possibly damaging Het
Gm44501 C T 17: 40,578,829 A78V possibly damaging Het
Gpr19 C A 6: 134,869,392 A443S probably damaging Het
Helb T C 10: 120,095,102 R729G probably null Het
Lnpep G T 17: 17,538,562 T840K probably benign Het
Mctp2 T C 7: 72,185,796 N551S probably benign Het
Mgam T G 6: 40,668,193 F635V probably damaging Het
Mlc1 G A 15: 88,964,170 A262V probably damaging Het
Muc5b A G 7: 141,862,239 Y2974C probably benign Het
Nprl3 A T 11: 32,248,150 Y208* probably null Het
Olfr1090 A T 2: 86,754,093 L215Q probably damaging Het
Olfr136 C T 17: 38,335,394 P79L probably benign Het
Pkn2 A G 3: 142,794,107 F915S probably damaging Het
Pkn3 G A 2: 30,090,584 C829Y probably benign Het
Polr1a C T 6: 71,941,512 P685S probably damaging Het
Ppp4r3b A G 11: 29,173,352 D16G probably benign Het
Ppwd1 C T 13: 104,217,206 R348H probably damaging Het
Pxdc1 T C 13: 34,639,063 T98A probably benign Het
Rhbdl1 T C 17: 25,836,193 I68V probably benign Het
Ror2 A G 13: 53,117,225 C365R probably damaging Het
Samd4b A T 7: 28,403,903 H43Q probably damaging Het
Sbf2 A T 7: 110,441,426 V398D probably benign Het
Sbno2 T C 10: 80,058,874 I1012M probably damaging Het
Strn T C 17: 78,677,372 T281A probably benign Het
Tmem45a A G 16: 56,825,737 L40P probably damaging Het
Tnn G A 1: 160,114,685 P1081L probably damaging Het
Unc80 T C 1: 66,677,385 V2888A probably benign Het
Other mutations in Syt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Syt4 APN 18 31447174 utr 5 prime probably benign
IGL01476:Syt4 APN 18 31441643 missense probably damaging 1.00
IGL02412:Syt4 APN 18 31443843 missense probably benign 0.19
IGL02550:Syt4 APN 18 31444193 missense probably damaging 1.00
IGL02996:Syt4 APN 18 31444146 missense probably damaging 1.00
F6893:Syt4 UTSW 18 31444221 missense possibly damaging 0.74
PIT4434001:Syt4 UTSW 18 31440331 missense probably damaging 1.00
R0103:Syt4 UTSW 18 31447220 start gained probably benign
R0526:Syt4 UTSW 18 31443746 missense possibly damaging 0.95
R1122:Syt4 UTSW 18 31440202 missense probably damaging 1.00
R1622:Syt4 UTSW 18 31444016 missense probably damaging 1.00
R1786:Syt4 UTSW 18 31443443 splice site probably benign
R1895:Syt4 UTSW 18 31444088 missense probably damaging 1.00
R2114:Syt4 UTSW 18 31440467 missense probably damaging 1.00
R2117:Syt4 UTSW 18 31440467 missense probably damaging 1.00
R2655:Syt4 UTSW 18 31443544 missense probably benign 0.01
R3079:Syt4 UTSW 18 31441685 missense probably benign 0.08
R3730:Syt4 UTSW 18 31444136 missense probably damaging 0.96
R4870:Syt4 UTSW 18 31447356 start gained probably benign
R7638:Syt4 UTSW 18 31443822 missense probably benign 0.20
R7646:Syt4 UTSW 18 31441605 missense possibly damaging 0.95
R7799:Syt4 UTSW 18 31440192 nonsense probably null
Y5404:Syt4 UTSW 18 31443791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTAGGTCAAGATGCAGGG -3'
(R):5'- GACCTCAGGTTAGTGGGAAAC -3'

Sequencing Primer
(F):5'- AGAGCGGCTTTACCCTTCAC -3'
(R):5'- GTGGGAAACATCACCATTACTCGTG -3'
Posted On2019-11-26