Incidental Mutation 'R7765:Gcnt1'
ID598216
Institutional Source Beutler Lab
Gene Symbol Gcnt1
Ensembl Gene ENSMUSG00000038843
Gene Nameglucosaminyl (N-acetyl) transferase 1, core 2
SynonymsC2 GlcNAcT, 5630400D21Rik, IGnT, beta-1, 6-N-acetylglucosaminyltransferase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7765 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location17326141-17356667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17329359 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 334 (G334D)
Ref Sequence ENSEMBL: ENSMUSP00000133935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169897] [ENSMUST00000174236]
PDB Structure
X-ray crystal structure of murine leukocyte-type Core 2 b1,6-N-acetylglucosaminyltransferase (C2GnT-L) [X-RAY DIFFRACTION]
X-ray crystal structure of murine leukocyte-type Core 2 b1,6-N-acetylglucosaminyltransferase (C2GnT-L) in complex with Galb1,3GalNAc [X-RAY DIFFRACTION]
Structure and mechanisim of core 2 beta1,6-n-acetylglucosaminyltransferase: a Metal-ion independent gt-a glycosyltransferase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000169897
AA Change: G334D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127835
Gene: ENSMUSG00000038843
AA Change: G334D

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
Pfam:Branch 123 392 9.3e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174236
AA Change: G334D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133935
Gene: ENSMUSG00000038843
AA Change: G334D

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Branch 127 396 5.7e-65 PFAM
Meta Mutation Damage Score 0.7532 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,6-N-acetylglucosaminyltransferase gene family. It is essential to the formation of Gal beta 1-3(GlcNAc beta 1-6)GalNAc structures and the core 2 O-glycan branch. The gene coding this enzyme was originally mapped to 9q21, but was later localized to 9q13. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele display a grossly normal phenotype and are fertile. There are abnormalities in white blood cell counts and in inflammatory response however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T A 10: 116,113,253 K123* probably null Het
Adam2 T C 14: 66,059,896 E187G probably damaging Het
Adam28 C T 14: 68,609,106 probably null Het
Ap2a1 G A 7: 44,909,736 T189M probably damaging Het
Apaf1 A G 10: 91,023,782 Y845H probably benign Het
Asb14 G T 14: 26,897,761 V55F probably benign Het
Brap A T 5: 121,662,129 D71V probably damaging Het
Ccdc93 T G 1: 121,499,313 F610V probably damaging Het
Cfap46 T G 7: 139,651,564 D911A Het
Chn2 T C 6: 54,298,152 probably null Het
Cib3 A G 8: 72,204,425 F156S probably damaging Het
Ctif A T 18: 75,605,644 V164D probably damaging Het
Ddx27 T A 2: 167,027,959 F405I probably damaging Het
Dnttip2 A G 3: 122,275,945 T270A probably benign Het
Dst T A 1: 34,275,694 S4455T probably damaging Het
Efcab8 A G 2: 153,843,190 K47R Het
Efhd2 T C 4: 141,874,575 E98G probably damaging Het
Fcmr T A 1: 130,874,288 L93Q probably damaging Het
Fhdc1 T A 3: 84,444,599 E1106D probably benign Het
Gm10031 G A 1: 156,524,784 G185D possibly damaging Het
Hltf T C 3: 20,091,483 F488L probably benign Het
Hmgxb4 C A 8: 75,000,808 H140N probably damaging Het
Ifi214 A T 1: 173,524,836 F342L probably damaging Het
Ip6k1 A G 9: 108,032,089 D105G possibly damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kif18a G A 2: 109,306,940 D506N probably benign Het
Klf17 T A 4: 117,760,615 M182L probably benign Het
Kmt2d A G 15: 98,852,334 F2493L unknown Het
Lefty1 A G 1: 180,936,547 E84G probably damaging Het
Lyst T G 13: 13,709,532 L2975R possibly damaging Het
Magea5 G A X: 155,054,178 P73S possibly damaging Het
Mctp2 T C 7: 72,090,331 probably null Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Myh8 T A 11: 67,303,655 I1564N probably benign Het
Npc1 A T 18: 12,195,048 M1068K probably benign Het
Nr2e1 A G 10: 42,574,437 C60R probably benign Het
Nrxn3 A G 12: 89,813,484 I29V probably benign Het
Ntsr1 T A 2: 180,538,817 H305Q probably damaging Het
Olfr1100 T A 2: 86,978,194 I201F probably damaging Het
Olfr1391 A G 11: 49,327,744 E111G probably damaging Het
Olfr955 A G 9: 39,470,316 S137P probably benign Het
Pate2 A C 9: 35,669,901 E22D probably benign Het
Pcdhb22 A G 18: 37,519,105 T209A probably damaging Het
Pdss2 C T 10: 43,464,632 S352F probably benign Het
Pfn3 T A 13: 55,415,087 D27V probably damaging Het
Pigg T G 5: 108,314,054 S84A probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rad51b T C 12: 79,803,270 probably null Het
Scn10a A G 9: 119,609,904 V1632A possibly damaging Het
Serpinb3d T G 1: 107,079,782 D158A probably damaging Het
Sh3yl1 T C 12: 30,958,869 L266P probably damaging Het
Sidt2 A T 9: 45,941,575 probably null Het
Stox1 C T 10: 62,665,999 V261M probably benign Het
Tll1 A G 8: 64,051,449 Y638H probably damaging Het
Tst A T 15: 78,405,616 M73K possibly damaging Het
Tuba4a C T 1: 75,216,359 V232M probably benign Het
Unk T A 11: 116,053,082 V343D probably benign Het
Usf3 T C 16: 44,219,063 V1302A probably benign Het
Usp32 A T 11: 84,994,408 L1271H probably damaging Het
Vwa5b2 C T 16: 20,594,611 P192L probably benign Het
Zfp995 A G 17: 21,882,003 Y38H probably damaging Het
Other mutations in Gcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02700:Gcnt1 APN 19 17329416 missense probably damaging 1.00
IGL02836:Gcnt1 APN 19 17330129 missense probably benign
IGL02977:Gcnt1 APN 19 17329374 missense probably damaging 1.00
IGL03302:Gcnt1 APN 19 17329183 missense probably benign 0.25
magenta UTSW 19 17329404 missense probably damaging 1.00
Violet UTSW 19 17329359 missense probably damaging 1.00
R0183:Gcnt1 UTSW 19 17329117 missense probably benign 0.23
R0440:Gcnt1 UTSW 19 17330316 missense probably benign 0.00
R1159:Gcnt1 UTSW 19 17329804 missense possibly damaging 0.90
R1523:Gcnt1 UTSW 19 17329833 missense probably damaging 1.00
R2240:Gcnt1 UTSW 19 17329331 missense possibly damaging 0.91
R4510:Gcnt1 UTSW 19 17330277 missense probably benign 0.00
R4511:Gcnt1 UTSW 19 17330277 missense probably benign 0.00
R5689:Gcnt1 UTSW 19 17329404 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGGGGTCGACATCCATG -3'
(R):5'- TGGAATAGTCAAAGCACCGCC -3'

Sequencing Primer
(F):5'- ACATCCATGTCAAACTTATTGGC -3'
(R):5'- GCCCCCACTGAAAACTCCTCTC -3'
Posted On2019-11-26